Mutagenetix > Incidental Mutation

Incidental Mutation 'R5386:Reln'

425198

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

Accession Numbers

Essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R5386 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21884454-22344702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22039529 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 817 (V817A)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000062372
AA Change: V817A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: V817A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161356
AA Change: V817A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: V817A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162427

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 134 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,194,413	G887R	probably damaging	Het
4931406P16Rik	A	G	7: 34,242,388	F120L	probably damaging	Het
Abcc12	T	G	8: 86,517,489	K1012Q	possibly damaging	Het
Afmid	G	A	11: 117,828,142	G33R	probably benign	Het
Agbl3	G	T	6: 34,799,196	W207C	probably damaging	Het
Ajuba	T	C	14: 54,570,398	Y459C	probably damaging	Het
Ak2	T	C	4: 129,008,172	S213P	probably benign	Het
Alk	T	A	17: 71,875,012	N1339Y	probably damaging	Het
Angpt1	T	C	15: 42,438,365	S416G	probably damaging	Het
Ank2	C	T	3: 126,981,933	V854M	probably benign	Het
Ankrd61	G	T	5: 143,891,664	N122K	possibly damaging	Het
Armc9	T	A	1: 86,198,289	L34Q	probably null	Het
Aspg	T	A	12: 112,123,032	V418E	probably benign	Het
Baz1b	C	T	5: 135,238,059	R1241C	probably damaging	Het
Bclaf1	T	C	10: 20,325,592	V201A	possibly damaging	Het
C1ql3	A	T	2: 13,004,358	D225E	probably damaging	Het
Capn9	A	G	8: 124,605,540	T417A	possibly damaging	Het
Card14	C	T	11: 119,317,289	R62C	probably damaging	Het
Cc2d2a	A	G	5: 43,730,041	N1271S	probably benign	Het
Ccpg1	G	A	9: 73,013,044	S647N	probably benign	Het
Cdv3	T	C	9: 103,355,230	K133R	possibly damaging	Het
Cep128	A	C	12: 90,999,571	S1087R	probably benign	Het
Cep70	T	A	9: 99,281,075	L325Q	probably damaging	Het
Chit1	T	G	1: 134,149,454	F332V	probably damaging	Het
Chodl	C	A	16: 78,946,697	T219K	probably damaging	Het
Cntn4	T	C	6: 106,181,804	L10P	possibly damaging	Het
Copg1	G	T	6: 87,890,207	M87I	possibly damaging	Het
Cyp3a59	A	G	5: 146,085,768	Y28C	probably benign	Het
Dchs1	A	C	7: 105,758,029	V2119G	probably damaging	Het
Dedd	T	C	1: 171,338,383	L23P	probably damaging	Het
Dmxl2	A	G	9: 54,378,757	S2715P	probably benign	Het
Dnah9	T	C	11: 66,029,356	N2237S	probably damaging	Het
Drosha	A	G	15: 12,842,121	I337V	probably benign	Het
Duox2	A	G	2: 122,295,136	V330A	probably benign	Het
Dusp11	T	C	6: 85,947,605	*322W	probably null	Het
Dusp8	T	A	7: 142,089,993	Q61L	possibly damaging	Het
Ears2	G	C	7: 122,044,377	T426S	probably benign	Het
Elmo1	T	C	13: 20,600,210	Y646H	probably benign	Het
Eps15	T	A	4: 109,321,225	I220K	possibly damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam171a2	C	A	11: 102,437,867	V689L	possibly damaging	Het
Fam213b	T	A	4: 154,899,005	M1L	probably benign	Het
Fam91a1	G	A	15: 58,448,394	S645N	probably benign	Het
Fancg	G	A	4: 43,007,076	Q234*	probably null	Het
Gid4	T	A	11: 60,432,442		probably null	Het
Gm14085	C	A	2: 122,522,778	L480I	probably benign	Het
Gm7361	A	C	5: 26,258,905	T53P	probably benign	Het
Golgb1	T	A	16: 36,912,315	C641*	probably null	Het
Gon4l	T	A	3: 88,858,496	M409K	probably benign	Het
Gpatch8	A	T	11: 102,508,227		probably null	Het
Gpr156	T	A	16: 37,948,309	V64E	possibly damaging	Het
Grid2	T	A	6: 63,931,105	I243K	probably damaging	Het
Gucy2g	G	A	19: 55,215,116	A750V	probably damaging	Het
Hdac5	T	C	11: 102,202,141	E590G	possibly damaging	Het
Herc3	T	A	6: 58,874,278	M504K	probably damaging	Het
Hif1a	A	G	12: 73,944,093	E713G	probably benign	Het
Hmx3	A	G	7: 131,544,304	D247G	probably damaging	Het
Hoxd11	G	T	2: 74,682,819	E143*	probably null	Het
Ifitm3	T	C	7: 141,010,641	N2S	probably benign	Het
Il17f	T	C	1: 20,777,957	Q99R	probably benign	Het
Itga6	T	A	2: 71,841,150	S341R	probably damaging	Het
Itgam	A	G	7: 128,107,980	N661S	probably benign	Het
Jag1	A	T	2: 137,095,544	H303Q	possibly damaging	Het
Kcnh8	T	A	17: 52,725,995	N103K	probably benign	Het
Kdm6b	T	C	11: 69,400,810		probably benign	Het
Keg1	A	C	19: 12,714,538	N63T	probably damaging	Het
Klf12	T	A	14: 99,900,159	H317L	probably damaging	Het
Lrp1	A	T	10: 127,592,114	V530E	probably damaging	Het
Mrgpra6	A	G	7: 47,188,881	C190R	probably damaging	Het
Myo1a	G	T	10: 127,705,897	E102*	probably null	Het
Napa	A	T	7: 16,116,472	E265D	probably benign	Het
Ncam1	A	C	9: 49,564,874	V305G	probably damaging	Het
Nek8	T	C	11: 78,170,437		probably null	Het
Olfr1115	C	T	2: 87,252,483	P182L	probably benign	Het
Olfr1242	G	T	2: 89,494,137	Y58*	probably null	Het
Olfr1275	T	C	2: 111,231,194	T200A	probably benign	Het
Olfr191	T	A	16: 59,085,890	M198L	probably benign	Het
Olfr243	T	C	7: 103,717,355	F254L	probably benign	Het
Olfr251	A	T	9: 38,377,985	I29F	probably benign	Het
Olfr739	T	A	14: 50,425,389	V290E	possibly damaging	Het
Olfr971	A	G	9: 39,839,830	Y132C	possibly damaging	Het
Olfr987	T	C	2: 85,331,635	T88A	probably benign	Het
Pabpc4	A	G	4: 123,294,997	Q417R	probably benign	Het
Panx3	A	T	9: 37,669,024	M11K	probably damaging	Het
Pcbp1	C	T	6: 86,525,489	E143K	probably damaging	Het
Pdcd7	G	A	9: 65,358,692	W477*	probably null	Het
Pi4k2a	G	A	19: 42,090,515	S5N	probably damaging	Het
Plag1	T	A	4: 3,904,075	Q372L	probably benign	Het
Plce1	C	A	19: 38,760,091	N1755K	probably damaging	Het
Pld4	G	T	12: 112,763,988	E102*	probably null	Het
Pnlip	A	G	19: 58,679,607	N345S	probably benign	Het
Ppm1e	A	T	11: 87,358,551	L118Q	possibly damaging	Het
Prkra	T	G	2: 76,639,278	T146P	probably damaging	Het
Prpf8	A	G	11: 75,495,799	D1038G	probably damaging	Het
Prss51	T	A	14: 64,097,094	V108E	probably damaging	Het
Ptch1	A	G	13: 63,545,043	Y181H	probably damaging	Het
Rictor	C	A	15: 6,789,504	Q1403K	probably benign	Het
Rims1	T	A	1: 22,412,245	I882F	probably damaging	Het
Rnf19a	A	G	15: 36,242,039	V618A	probably benign	Het
Ryr1	A	T	7: 29,117,416	I65N	probably damaging	Het
S1pr2	T	C	9: 20,967,594	T313A	probably benign	Het
Serpine2	A	T	1: 79,821,287	Y83*	probably null	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Sgip1	T	C	4: 102,915,059	V215A	probably benign	Het
Sgsm3	T	C	15: 81,007,999	V256A	probably benign	Het
Shroom4	T	A	X: 6,585,469	C894*	probably null	Het
Slc14a2	T	A	18: 78,185,840	D306V	possibly damaging	Het
Slc4a10	A	T	2: 62,290,058	E843V	probably damaging	Het
Smyd4	T	A	11: 75,390,156	C152S	probably damaging	Het
Snx10	T	C	6: 51,575,972	Y32H	probably damaging	Het
Sorl1	T	C	9: 42,057,284	T558A	possibly damaging	Het
Spata31d1b	G	A	13: 59,719,052	C1338Y	possibly damaging	Het
Sppl2c	T	A	11: 104,187,301	I309K	possibly damaging	Het
Stard9	A	G	2: 120,700,630	E2456G	probably damaging	Het
Stx1b	A	T	7: 127,815,403	D16E	probably benign	Het
Tecpr2	T	C	12: 110,915,453	V152A	probably damaging	Het
Tedc1	T	C	12: 113,156,682	V47A	probably benign	Het
Tep1	A	T	14: 50,868,317	L82Q	probably damaging	Het
Tgm4	A	G	9: 123,056,494	Y367C	probably damaging	Het
Tle1	C	T	4: 72,141,844	V258M	probably damaging	Het
Tm9sf1	C	T	14: 55,642,844	G32D	possibly damaging	Het
Tmco2	A	G	4: 121,105,984	L106P	probably damaging	Het
Tmem131	A	T	1: 36,872,558	C103S	possibly damaging	Het
Tmprss7	T	A	16: 45,669,528	I444F	possibly damaging	Het
Trank1	T	C	9: 111,362,402	V493A	probably benign	Het
Trim80	A	T	11: 115,448,017	T558S	probably benign	Het
Trmt6	C	A	2: 132,808,783	A302S	probably benign	Het
Ttc17	A	T	2: 94,303,640	W1067R	probably damaging	Het
Tulp4	T	A	17: 6,236,293	V1532D	probably damaging	Het
Ubqlnl	T	G	7: 104,149,217	I358L	probably benign	Het
Ulk3	T	A	9: 57,590,740	I108N	possibly damaging	Het
Vps13b	A	T	15: 35,640,528		probably null	Het
Vwa3a	A	G	7: 120,790,142	K68E	possibly damaging	Het
Zfp746	G	T	6: 48,064,176	H538N	possibly damaging	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22010127	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22045009	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22154950	missense	probably benign	0.01
IGL00755:Reln	APN	5	22060380	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22018850	critical splice donor site	probably null
IGL00900:Reln	APN	5	21980117	missense	probably damaging	0.98
IGL01067:Reln	APN	5	21979666	missense	probably damaging	1.00
IGL01104:Reln	APN	5	21986967	missense	probably damaging	0.99
IGL01141:Reln	APN	5	21969033	missense	probably damaging	1.00
IGL01141:Reln	APN	5	21919069	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22171251	missense	probably damaging	0.99
IGL01341:Reln	APN	5	21969079	missense	probably damaging	1.00
IGL01354:Reln	APN	5	21919175	nonsense	probably null
IGL01361:Reln	APN	5	21919021	missense	probably benign	0.06
IGL01446:Reln	APN	5	21969317	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22040405	missense	probably benign	0.40
IGL01612:Reln	APN	5	21896930	missense	probably damaging	0.99
IGL01695:Reln	APN	5	21920438	missense	probably damaging	1.00
IGL01718:Reln	APN	5	21947514	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22344246	nonsense	probably null
IGL01875:Reln	APN	5	21904717	missense	probably benign
IGL02013:Reln	APN	5	21950879	missense	probably damaging	1.00
IGL02031:Reln	APN	5	21979016	missense	probably damaging	0.99
IGL02186:Reln	APN	5	21909958	missense	probably damaging	1.00
IGL02228:Reln	APN	5	21904731	missense	probably damaging	0.99
IGL02248:Reln	APN	5	21910992	missense	probably damaging	1.00
IGL02336:Reln	APN	5	21929134	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22080791	nonsense	probably null
IGL02408:Reln	APN	5	21901619	missense	probably benign	0.44
IGL02415:Reln	APN	5	21971951	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22040427	missense	probably benign	0.00
IGL02540:Reln	APN	5	22034752	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22103357	missense	probably benign	0.09
IGL02720:Reln	APN	5	21997941	missense	probably damaging	0.99
IGL02894:Reln	APN	5	21885548	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	21995365	missense	probably damaging	1.00
IGL03125:Reln	APN	5	21910844	missense	probably damaging	1.00
IGL03298:Reln	APN	5	21910836	missense	probably damaging	0.99
Fishing	UTSW	5	21896841	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22106060	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	21925371	missense	probably benign	0.01
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22004136	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22128649	missense	probably damaging	0.99
R0144:Reln	UTSW	5	21948449	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0266:Reln	UTSW	5	21988776	missense	probably damaging	1.00
R0269:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22227513	splice site	probably benign
R0333:Reln	UTSW	5	21929242	missense	probably damaging	0.97
R0357:Reln	UTSW	5	21950822	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22048800	missense	probably damaging	0.98
R0506:Reln	UTSW	5	21920496	missense	probably damaging	0.97
R0534:Reln	UTSW	5	21947408	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22051276	splice site	probably benign
R0541:Reln	UTSW	5	21980109	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22010150	missense	probably benign	0.36
R0617:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22018869	missense	probably damaging	1.00
R0653:Reln	UTSW	5	21913230	missense	probably benign	0.44
R0704:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0706:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22227628	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22034664	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22034775	missense	probably benign
R1163:Reln	UTSW	5	21899029	missense	probably benign	0.03
R1222:Reln	UTSW	5	21986955	missense	probably null	0.97
R1226:Reln	UTSW	5	21910866	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22128602	splice site	probably benign
R1532:Reln	UTSW	5	22034744	missense	probably damaging	0.99
R1552:Reln	UTSW	5	21960378	missense	probably benign	0.01
R1565:Reln	UTSW	5	21925213	missense	probably benign	0.05
R1618:Reln	UTSW	5	22060368	missense	probably benign	0.01
R1636:Reln	UTSW	5	21998683	missense	probably damaging	0.99
R1664:Reln	UTSW	5	21929086	missense	probably damaging	1.00
R1716:Reln	UTSW	5	21955095	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22010289	missense	probably damaging	0.99
R1835:Reln	UTSW	5	21979002	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22044962	critical splice donor site	probably null
R1991:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	21942627	missense	probably benign	0.01
R2072:Reln	UTSW	5	21919177	missense	probably damaging	1.00
R2103:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22019000	missense	probably damaging	1.00
R2120:Reln	UTSW	5	21969085	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22048005	missense	probably benign	0.30
R2219:Reln	UTSW	5	21972047	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	21987078	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	21896786	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22154956	missense	probably benign	0.00
R2321:Reln	UTSW	5	21915020	missense	probably damaging	0.99
R2512:Reln	UTSW	5	21979690	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22344369	missense	unknown
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22040420	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	21995589	splice site	probably benign
R3713:Reln	UTSW	5	21904734	missense	probably damaging	0.99
R3770:Reln	UTSW	5	21948566	missense	probably damaging	1.00
R3836:Reln	UTSW	5	21911014	missense	probably damaging	1.00
R3887:Reln	UTSW	5	21910849	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	21979001	missense	probably damaging	0.99
R3975:Reln	UTSW	5	21995366	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22227630	missense	probably benign	0.45
R4044:Reln	UTSW	5	22128632	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22034584	missense	probably damaging	1.00
R4297:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4298:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4299:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4518:Reln	UTSW	5	21901743	missense	probably benign	0.44
R4615:Reln	UTSW	5	21972872	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22152463	missense	probably benign	0.17
R4720:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	21919222	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22049700	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22344185	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22018846	splice site	probably null
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4896:Reln	UTSW	5	21955238	missense	probably damaging	1.00
R4908:Reln	UTSW	5	21979720	missense	probably benign	0.02
R4912:Reln	UTSW	5	21925193	missense	probably benign	0.29
R4922:Reln	UTSW	5	21995587	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	21960426	missense	probably damaging	1.00
R4976:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5020:Reln	UTSW	5	22034638	missense	probably damaging	1.00
R5037:Reln	UTSW	5	21948512	missense	probably damaging	1.00
R5082:Reln	UTSW	5	21896077	missense	probably benign	0.00
R5119:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5125:Reln	UTSW	5	21913241	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R5152:Reln	UTSW	5	21948629	missense	probably damaging	1.00
R5154:Reln	UTSW	5	21988765	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22103397	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22011163	missense	probably damaging	1.00
R5400:Reln	UTSW	5	21979714	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22004203	missense	probably benign	0.00
R5514:Reln	UTSW	5	21971885	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	21932715	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22039665	nonsense	probably null
R5648:Reln	UTSW	5	21998572	missense	probably benign	0.04
R5649:Reln	UTSW	5	21901625	missense	probably benign	0.33
R5744:Reln	UTSW	5	22106083	missense	probably null	0.39
R5782:Reln	UTSW	5	22018056	missense	probably benign	0.01
R5815:Reln	UTSW	5	21947433	missense	probably damaging	0.99
R5838:Reln	UTSW	5	21899113	missense	probably damaging	0.97
R6162:Reln	UTSW	5	21911050	missense	probably damaging	1.00
R6219:Reln	UTSW	5	21948596	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22060333	missense	probably damaging	0.99
R6279:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22286944	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22152484	nonsense	probably null
R6351:Reln	UTSW	5	21901663	nonsense	probably null
R6369:Reln	UTSW	5	22051361	missense	probably benign	0.03
R6371:Reln	UTSW	5	21995513	missense	probably benign
R6374:Reln	UTSW	5	22080714	missense	probably benign	0.06
R6425:Reln	UTSW	5	21911020	nonsense	probably null
R6442:Reln	UTSW	5	21932776	missense	probably benign
R6445:Reln	UTSW	5	21919214	missense	probably benign	0.05
R6554:Reln	UTSW	5	21896840	missense	probably damaging	1.00
R6641:Reln	UTSW	5	21929134	missense	probably damaging	1.00
R6768:Reln	UTSW	5	21978907	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22034570	missense	probably damaging	1.00
R6896:Reln	UTSW	5	21899179	missense	probably benign	0.18
R6932:Reln	UTSW	5	21985857	missense	probably benign	0.00
R6948:Reln	UTSW	5	21972035	missense	probably damaging	1.00
R6959:Reln	UTSW	5	21976564	missense	probably damaging	1.00
R7085:Reln	UTSW	5	21915087	nonsense	probably null
R7091:Reln	UTSW	5	21899029	missense	probably null	0.08
R7135:Reln	UTSW	5	21976596	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22106097	missense	probably damaging	0.97
R7167:Reln	UTSW	5	21942620	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22047947	missense	probably damaging	1.00
R7256:Reln	UTSW	5	21978923	missense	probably benign	0.03
R7393:Reln	UTSW	5	21976351	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22051367	missense	probably damaging	0.99
R7400:Reln	UTSW	5	21971934	missense	probably damaging	0.99
R7426:Reln	UTSW	5	21971953	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22103435	missense	probably damaging	0.98
R7470:Reln	UTSW	5	21942741	missense	probably damaging	0.99
R7473:Reln	UTSW	5	21929127	missense	probably benign	0.25
R7501:Reln	UTSW	5	22227638	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R7544:Reln	UTSW	5	21976278	nonsense	probably null
R7588:Reln	UTSW	5	21885568	missense	probably benign	0.03
R7631:Reln	UTSW	5	21971935	missense	probably damaging	0.97
R7644:Reln	UTSW	5	21978931	missense	probably benign	0.39
R7834:Reln	UTSW	5	22039635	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22134692	missense	probably benign	0.00
R7938:Reln	UTSW	5	21950872	missense	probably damaging	0.97
R8006:Reln	UTSW	5	21899084	nonsense	probably null
R8062:Reln	UTSW	5	21971992	missense	probably benign	0.00
R8222:Reln	UTSW	5	21931477	nonsense	probably null
R8266:Reln	UTSW	5	22018087	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22004112	missense	probably damaging	1.00
R8487:Reln	UTSW	5	21899029	missense	probably benign	0.03
R8523:Reln	UTSW	5	22004231	missense	probably damaging	1.00
R8751:Reln	UTSW	5	21942674	missense	probably benign	0.37
R8801:Reln	UTSW	5	21950856	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	21925259	missense	probably damaging	0.98
R8978:Reln	UTSW	5	21885514	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	21899157	missense	probably damaging	0.97
R8995:Reln	UTSW	5	21979579	missense	probably benign	0.00
R9022:Reln	UTSW	5	21976615	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22048038	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22011061	missense	probably damaging	1.00
R9089:Reln	UTSW	5	21925200	missense	probably benign	0.01
R9126:Reln	UTSW	5	21955196	missense	probably damaging	1.00
R9172:Reln	UTSW	5	21950817	critical splice donor site	probably null
R9182:Reln	UTSW	5	21901619	missense	probably benign	0.44
R9196:Reln	UTSW	5	22152473	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22344202	nonsense	probably null
R9241:Reln	UTSW	5	21969069	missense	probably damaging	0.99
R9244:Reln	UTSW	5	21915153	missense	probably damaging	0.99
R9281:Reln	UTSW	5	21948547	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22004211	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	21988707	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22080691	missense	probably benign	0.01
R9309:Reln	UTSW	5	21971868	missense	probably benign	0.37
R9338:Reln	UTSW	5	21997939	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22344204	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	21915107	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22344200	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	21920510	missense	possibly damaging	0.46
R9717:Reln	UTSW	5	21931429	missense	probably benign	0.26
R9745:Reln	UTSW	5	21947527	missense	probably damaging	1.00
R9778:Reln	UTSW	5	21950945	missense	probably damaging	1.00
Z1176:Reln	UTSW	5	21979024	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	21969241	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22004082	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22154959	missense	probably benign	0.05
Z1177:Reln	UTSW	5	22227636	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGTATAGGCTGTAGTTCTTTCC -3'
(R):5'- TGTGCTCACTAATCATGAGTTACTC -3'

Sequencing Primer
(F):5'- TTGAAGTATTGAAATCAGCAGGAC -3'
(R):5'- CTAATCATGAGTTACTCGTGTCTAGG -3'

Posted On

2016-08-04