Incidental Mutation 'R0492:Ly75'
ID42520
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Namelymphocyte antigen 75
SynonymsDEC-205, CD205
MMRRC Submission 038690-MU
Accession Numbers

Genbank: NM_013825

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0492 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location60292103-60383303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60308276 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1416 (W1416R)
Ref Sequence ENSEMBL: ENSMUSP00000108152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
Predicted Effect probably damaging
Transcript: ENSMUST00000028362
AA Change: W1416R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: W1416R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112533
AA Change: W1416R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: W1416R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Meta Mutation Damage Score 0.9270 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 99% (99/100)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A T 5: 24,554,628 L48Q probably damaging Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Adgre1 A G 17: 57,402,742 D133G unknown Het
AI314180 A G 4: 58,864,418 W288R probably damaging Het
Alpl A C 4: 137,749,576 probably null Het
Ankrd65 T C 4: 155,790,676 probably benign Het
Baalc A T 15: 38,934,085 probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Bud31 A G 5: 145,146,455 Y77C probably damaging Het
Capsl A G 15: 9,461,844 probably benign Het
Ccna1 A G 3: 55,048,583 V116A probably damaging Het
Cdc42bpa C A 1: 180,101,190 H723N probably benign Het
Cfap161 T C 7: 83,794,037 I40V possibly damaging Het
CK137956 C T 4: 127,951,300 V217I probably benign Het
Cog5 A G 12: 31,869,461 T540A probably damaging Het
Cps1 T C 1: 67,157,836 W349R probably damaging Het
Crispld2 G T 8: 120,026,067 V285L probably benign Het
Crtc2 T A 3: 90,263,497 F626I probably damaging Het
Daam1 G A 12: 71,944,380 R256H unknown Het
Dhx38 G T 8: 109,561,944 probably benign Het
Dok4 G A 8: 94,865,136 A324V probably benign Het
Dscam T C 16: 96,825,782 probably null Het
Dusp16 A T 6: 134,718,402 S489T probably benign Het
Erbin A T 13: 103,834,358 Y917N probably damaging Het
F13b A T 1: 139,522,559 probably null Het
Fam26f G A 10: 34,127,651 R87* probably null Het
Fdx1 C A 9: 51,963,425 A15S probably benign Het
Ffar4 A T 19: 38,097,182 Q19L probably benign Het
Folh1 A C 7: 86,746,192 V344G probably damaging Het
Fscb T A 12: 64,473,518 E391D possibly damaging Het
Gigyf2 G A 1: 87,440,846 G1083R probably damaging Het
Gm14403 C A 2: 177,508,566 H102N probably benign Het
Gm4847 A G 1: 166,630,392 F464S probably damaging Het
Gpam A T 19: 55,096,179 M56K possibly damaging Het
Gpr165 T A X: 96,717,172 F352I probably damaging Het
Grik2 T G 10: 49,101,164 I891L probably damaging Het
Gsr T C 8: 33,681,575 probably benign Het
Hhla1 A G 15: 65,936,291 F302L probably benign Het
Impg1 T C 9: 80,345,308 D453G possibly damaging Het
Inpp5d T A 1: 87,698,150 V495E possibly damaging Het
Iqce A T 5: 140,675,235 L450H probably damaging Het
Itfg2 A G 6: 128,413,523 probably null Het
Kif13a A G 13: 46,812,742 V400A possibly damaging Het
Kif7 T C 7: 79,713,881 Y93C probably damaging Het
Krt33a A G 11: 100,016,083 V22A probably benign Het
Lct T C 1: 128,300,582 D1058G probably damaging Het
Lrp6 G T 6: 134,480,518 D774E possibly damaging Het
Lrrc9 T A 12: 72,478,763 S828R possibly damaging Het
Mdh2 T C 5: 135,790,150 I320T possibly damaging Het
Med13l T A 5: 118,738,495 V912E probably damaging Het
Mgarp T C 3: 51,389,035 D182G possibly damaging Het
Mllt10 T C 2: 18,146,887 probably benign Het
Mmp28 G A 11: 83,443,803 A375V probably damaging Het
Mrps23 T A 11: 88,210,685 H133Q probably benign Het
Msh6 T C 17: 87,975,251 S35P probably benign Het
Myo3a A G 2: 22,323,636 D347G possibly damaging Het
Npc1l1 T C 11: 6,223,040 K800E possibly damaging Het
Olfr1034 T C 2: 86,046,587 V35A probably benign Het
Olfr1034 T C 2: 86,046,934 F151L possibly damaging Het
Olfr1086 G A 2: 86,676,490 P281L probably damaging Het
Olfr152 T G 2: 87,782,822 I94S probably damaging Het
Olfr414 T A 1: 174,430,563 I45N possibly damaging Het
Olfr632 T C 7: 103,937,764 I128T probably benign Het
Olfr695 A T 7: 106,873,877 Y123N probably damaging Het
Osmr A C 15: 6,824,518 W570G probably damaging Het
Otol1 A T 3: 70,027,784 I370F probably damaging Het
Pank2 A G 2: 131,280,260 Y235C probably damaging Het
Pias2 T C 18: 77,105,885 S187P probably damaging Het
Pkhd1l1 A G 15: 44,519,690 N1115S probably benign Het
Pld1 G T 3: 28,109,817 A800S probably damaging Het
Prex2 T C 1: 11,186,633 probably benign Het
Ptpn3 T C 4: 57,194,304 Q908R probably benign Het
Rab3gap2 T A 1: 185,252,392 probably benign Het
Rbm24 A T 13: 46,420,350 N82Y probably damaging Het
Rpl27 T C 11: 101,445,255 V47A possibly damaging Het
Serpina1f A G 12: 103,693,567 V152A possibly damaging Het
Serpina5 A G 12: 104,102,133 Y151C probably damaging Het
Serpinb7 A G 1: 107,452,007 *381W probably null Het
Sh2b2 A G 5: 136,232,263 F33S probably damaging Het
Slc22a2 A C 17: 12,615,272 I476L probably benign Het
Slc6a12 A T 6: 121,355,372 I222F probably benign Het
Smim26 G A 2: 144,595,113 D61N probably damaging Het
Soat1 A T 1: 156,441,354 Y209N probably benign Het
Sorl1 T C 9: 41,991,371 H1630R probably null Het
Sptlc2 A T 12: 87,346,806 probably null Het
Strn3 G A 12: 51,610,404 T642I probably damaging Het
Syce1l T A 8: 113,654,068 D137E possibly damaging Het
Syne2 T C 12: 75,982,063 probably null Het
Tcf25 C A 8: 123,381,464 P86Q probably benign Het
Tmem19 A T 10: 115,361,810 Y43* probably null Het
Tmem30b T C 12: 73,546,168 N58D probably benign Het
Tnn A C 1: 160,120,757 I795M probably damaging Het
Tnpo1 A G 13: 98,855,446 Y641H probably damaging Het
Tra2a A T 6: 49,250,955 probably benign Het
Trappc8 A T 18: 20,866,186 F295I probably benign Het
Vmn2r101 T A 17: 19,588,983 W125R probably damaging Het
Vps8 C A 16: 21,442,357 F82L probably damaging Het
Ythdf2 A T 4: 132,204,468 S460R probably damaging Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60376077 missense probably damaging 1.00
IGL01072:Ly75 APN 2 60354496 missense probably damaging 1.00
IGL01409:Ly75 APN 2 60321692 splice site probably null
IGL01432:Ly75 APN 2 60376007 missense probably damaging 1.00
IGL01626:Ly75 APN 2 60301015 missense probably benign 0.13
IGL01690:Ly75 APN 2 60338311 missense probably damaging 1.00
IGL01862:Ly75 APN 2 60299172 missense probably damaging 1.00
IGL01982:Ly75 APN 2 60311764 missense probably damaging 1.00
IGL02075:Ly75 APN 2 60352356 missense probably damaging 0.99
IGL02338:Ly75 APN 2 60354452 missense probably benign 0.04
IGL02364:Ly75 APN 2 60358507 missense probably damaging 1.00
IGL02456:Ly75 APN 2 60293781 missense probably benign 0.09
IGL02474:Ly75 APN 2 60383182 missense probably null 1.00
IGL02608:Ly75 APN 2 60321900 missense probably benign 0.41
IGL02986:Ly75 APN 2 60308191 missense probably damaging 1.00
IGL03015:Ly75 APN 2 60376160 missense probably damaging 1.00
IGL03049:Ly75 APN 2 60352070 missense probably damaging 0.99
euphues UTSW 2 60299045 critical splice donor site probably null
four_score UTSW 2 60311771 missense possibly damaging 0.75
lyly UTSW 2 60327873 missense possibly damaging 0.49
Witty UTSW 2 60354500 missense probably damaging 1.00
D605:Ly75 UTSW 2 60352352 critical splice donor site probably null
R0046:Ly75 UTSW 2 60339457 intron probably benign
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0285:Ly75 UTSW 2 60318319 missense probably damaging 1.00
R0387:Ly75 UTSW 2 60306404 missense probably benign 0.20
R0688:Ly75 UTSW 2 60316221 missense probably benign 0.41
R1367:Ly75 UTSW 2 60293758 unclassified probably null
R1463:Ly75 UTSW 2 60368757 critical splice donor site probably null
R1581:Ly75 UTSW 2 60327893 missense probably damaging 1.00
R1663:Ly75 UTSW 2 60314234 missense probably damaging 1.00
R1818:Ly75 UTSW 2 60311777 missense probably damaging 1.00
R1881:Ly75 UTSW 2 60349940 missense probably benign 0.00
R2244:Ly75 UTSW 2 60349913 missense probably benign 0.01
R2905:Ly75 UTSW 2 60334554 missense probably benign 0.00
R3967:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60352995 missense probably damaging 1.00
R4406:Ly75 UTSW 2 60354550 missense probably damaging 1.00
R4526:Ly75 UTSW 2 60330773 missense probably benign 0.09
R4647:Ly75 UTSW 2 60308278 missense probably damaging 1.00
R4795:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4796:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4962:Ly75 UTSW 2 60352125 missense probably damaging 1.00
R4979:Ly75 UTSW 2 60375894 missense probably damaging 1.00
R5072:Ly75 UTSW 2 60375963 missense probably damaging 1.00
R5288:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5373:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60334487 nonsense probably null
R5385:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5395:Ly75 UTSW 2 60365111 missense probably benign 0.41
R5531:Ly75 UTSW 2 60365145 missense probably damaging 0.98
R5662:Ly75 UTSW 2 60352381 missense probably damaging 1.00
R5667:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5668:Ly75 UTSW 2 60354500 missense probably damaging 1.00
R5671:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5677:Ly75 UTSW 2 60299082 missense probably benign 0.00
R5764:Ly75 UTSW 2 60318439 missense probably benign
R5896:Ly75 UTSW 2 60383146 missense probably benign
R6025:Ly75 UTSW 2 60375962 missense probably damaging 1.00
R6113:Ly75 UTSW 2 60368873 missense probably benign 0.04
R6448:Ly75 UTSW 2 60299045 critical splice donor site probably null
R6601:Ly75 UTSW 2 60318376 missense probably benign 0.11
R6745:Ly75 UTSW 2 60308179 missense probably damaging 1.00
R6955:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60306405 missense probably benign
R7100:Ly75 UTSW 2 60306434 missense probably benign
R7110:Ly75 UTSW 2 60376184 missense probably benign 0.31
R7203:Ly75 UTSW 2 60323852 nonsense probably null
R7291:Ly75 UTSW 2 60329993 missense probably damaging 0.98
R7308:Ly75 UTSW 2 60334515 missense probably benign 0.04
R7447:Ly75 UTSW 2 60334474 nonsense probably null
R7512:Ly75 UTSW 2 60334563 missense probably damaging 1.00
R7595:Ly75 UTSW 2 60293827 missense probably benign 0.01
R8005:Ly75 UTSW 2 60332934 missense probably damaging 1.00
X0025:Ly75 UTSW 2 60354475 missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60350004 nonsense probably null
Z1177:Ly75 UTSW 2 60352133 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ACTTCAGGGACCAGATAGAGCACAG -3'
(R):5'- GTAACTGCCTCCTTTACAGTCAGCC -3'

Sequencing Primer
(F):5'- TTAATCCTGTGAACCCGAGATGG -3'
(R):5'- CCTGCCACAGTTCATTCCAT -3'
Posted On2013-05-23