Incidental Mutation 'R5386:Ryr1'
ID 425216
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Name ryanodine receptor 1, skeletal muscle
Synonyms skrr, calcium release channel isoform 1, Ryr
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5386 (G1)
Quality Score 190
Status Not validated
Chromosome 7
Chromosomal Location 29003344-29125179 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 29117416 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 65 (I65N)
Ref Sequence ENSEMBL: ENSMUSP00000137123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000032813
AA Change: I65N

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: I65N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179893
AA Change: I65N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: I65N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207783
Predicted Effect possibly damaging
Transcript: ENSMUST00000214374
AA Change: I65N

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,194,413 G887R probably damaging Het
4931406P16Rik A G 7: 34,242,388 F120L probably damaging Het
Abcc12 T G 8: 86,517,489 K1012Q possibly damaging Het
Afmid G A 11: 117,828,142 G33R probably benign Het
Agbl3 G T 6: 34,799,196 W207C probably damaging Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Ak2 T C 4: 129,008,172 S213P probably benign Het
Alk T A 17: 71,875,012 N1339Y probably damaging Het
Angpt1 T C 15: 42,438,365 S416G probably damaging Het
Ank2 C T 3: 126,981,933 V854M probably benign Het
Ankrd61 G T 5: 143,891,664 N122K possibly damaging Het
Armc9 T A 1: 86,198,289 L34Q probably null Het
Aspg T A 12: 112,123,032 V418E probably benign Het
Baz1b C T 5: 135,238,059 R1241C probably damaging Het
Bclaf1 T C 10: 20,325,592 V201A possibly damaging Het
C1ql3 A T 2: 13,004,358 D225E probably damaging Het
Capn9 A G 8: 124,605,540 T417A possibly damaging Het
Card14 C T 11: 119,317,289 R62C probably damaging Het
Cc2d2a A G 5: 43,730,041 N1271S probably benign Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cdv3 T C 9: 103,355,230 K133R possibly damaging Het
Cep128 A C 12: 90,999,571 S1087R probably benign Het
Cep70 T A 9: 99,281,075 L325Q probably damaging Het
Chit1 T G 1: 134,149,454 F332V probably damaging Het
Chodl C A 16: 78,946,697 T219K probably damaging Het
Cntn4 T C 6: 106,181,804 L10P possibly damaging Het
Copg1 G T 6: 87,890,207 M87I possibly damaging Het
Cyp3a59 A G 5: 146,085,768 Y28C probably benign Het
Dchs1 A C 7: 105,758,029 V2119G probably damaging Het
Dedd T C 1: 171,338,383 L23P probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnah9 T C 11: 66,029,356 N2237S probably damaging Het
Drosha A G 15: 12,842,121 I337V probably benign Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp11 T C 6: 85,947,605 *322W probably null Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Ears2 G C 7: 122,044,377 T426S probably benign Het
Elmo1 T C 13: 20,600,210 Y646H probably benign Het
Eps15 T A 4: 109,321,225 I220K possibly damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam171a2 C A 11: 102,437,867 V689L possibly damaging Het
Fam213b T A 4: 154,899,005 M1L probably benign Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fancg G A 4: 43,007,076 Q234* probably null Het
Gid4 T A 11: 60,432,442 probably null Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gm7361 A C 5: 26,258,905 T53P probably benign Het
Golgb1 T A 16: 36,912,315 C641* probably null Het
Gon4l T A 3: 88,858,496 M409K probably benign Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gpr156 T A 16: 37,948,309 V64E possibly damaging Het
Grid2 T A 6: 63,931,105 I243K probably damaging Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hdac5 T C 11: 102,202,141 E590G possibly damaging Het
Herc3 T A 6: 58,874,278 M504K probably damaging Het
Hif1a A G 12: 73,944,093 E713G probably benign Het
Hmx3 A G 7: 131,544,304 D247G probably damaging Het
Hoxd11 G T 2: 74,682,819 E143* probably null Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Il17f T C 1: 20,777,957 Q99R probably benign Het
Itga6 T A 2: 71,841,150 S341R probably damaging Het
Itgam A G 7: 128,107,980 N661S probably benign Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kcnh8 T A 17: 52,725,995 N103K probably benign Het
Kdm6b T C 11: 69,400,810 probably benign Het
Keg1 A C 19: 12,714,538 N63T probably damaging Het
Klf12 T A 14: 99,900,159 H317L probably damaging Het
Lrp1 A T 10: 127,592,114 V530E probably damaging Het
Mrgpra6 A G 7: 47,188,881 C190R probably damaging Het
Myo1a G T 10: 127,705,897 E102* probably null Het
Napa A T 7: 16,116,472 E265D probably benign Het
Ncam1 A C 9: 49,564,874 V305G probably damaging Het
Nek8 T C 11: 78,170,437 probably null Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1242 G T 2: 89,494,137 Y58* probably null Het
Olfr1275 T C 2: 111,231,194 T200A probably benign Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Olfr243 T C 7: 103,717,355 F254L probably benign Het
Olfr251 A T 9: 38,377,985 I29F probably benign Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Olfr971 A G 9: 39,839,830 Y132C possibly damaging Het
Olfr987 T C 2: 85,331,635 T88A probably benign Het
Pabpc4 A G 4: 123,294,997 Q417R probably benign Het
Panx3 A T 9: 37,669,024 M11K probably damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pi4k2a G A 19: 42,090,515 S5N probably damaging Het
Plag1 T A 4: 3,904,075 Q372L probably benign Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pld4 G T 12: 112,763,988 E102* probably null Het
Pnlip A G 19: 58,679,607 N345S probably benign Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Ptch1 A G 13: 63,545,043 Y181H probably damaging Het
Reln A G 5: 22,039,529 V817A probably benign Het
Rictor C A 15: 6,789,504 Q1403K probably benign Het
Rims1 T A 1: 22,412,245 I882F probably damaging Het
Rnf19a A G 15: 36,242,039 V618A probably benign Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Serpine2 A T 1: 79,821,287 Y83* probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc14a2 T A 18: 78,185,840 D306V possibly damaging Het
Slc4a10 A T 2: 62,290,058 E843V probably damaging Het
Smyd4 T A 11: 75,390,156 C152S probably damaging Het
Snx10 T C 6: 51,575,972 Y32H probably damaging Het
Sorl1 T C 9: 42,057,284 T558A possibly damaging Het
Spata31d1b G A 13: 59,719,052 C1338Y possibly damaging Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Tecpr2 T C 12: 110,915,453 V152A probably damaging Het
Tedc1 T C 12: 113,156,682 V47A probably benign Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tgm4 A G 9: 123,056,494 Y367C probably damaging Het
Tle1 C T 4: 72,141,844 V258M probably damaging Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tmco2 A G 4: 121,105,984 L106P probably damaging Het
Tmem131 A T 1: 36,872,558 C103S possibly damaging Het
Tmprss7 T A 16: 45,669,528 I444F possibly damaging Het
Trank1 T C 9: 111,362,402 V493A probably benign Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Tulp4 T A 17: 6,236,293 V1532D probably damaging Het
Ubqlnl T G 7: 104,149,217 I358L probably benign Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vps13b A T 15: 35,640,528 probably null Het
Vwa3a A G 7: 120,790,142 K68E possibly damaging Het
Zfp746 G T 6: 48,064,176 H538N possibly damaging Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 29102810 missense probably damaging 1.00
IGL00335:Ryr1 APN 7 29124960 splice site probably null
IGL00427:Ryr1 APN 7 29104737 splice site probably benign
IGL00559:Ryr1 APN 7 29012242 splice site probably benign
IGL00803:Ryr1 APN 7 29069645 missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 29024229 missense probably damaging 1.00
IGL00948:Ryr1 APN 7 29020195 missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 29082543 missense probably damaging 0.99
IGL01116:Ryr1 APN 7 29100202 splice site probably benign
IGL01385:Ryr1 APN 7 29056985 missense probably damaging 1.00
IGL01482:Ryr1 APN 7 29052337 missense probably damaging 1.00
IGL01529:Ryr1 APN 7 29075227 missense probably damaging 1.00
IGL01543:Ryr1 APN 7 29091076 missense probably damaging 1.00
IGL01653:Ryr1 APN 7 29078597 missense probably damaging 0.99
IGL01701:Ryr1 APN 7 29059810 missense probably damaging 0.98
IGL02051:Ryr1 APN 7 29071658 missense probably benign 0.16
IGL02152:Ryr1 APN 7 29052015 missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 29094047 missense probably benign 0.07
IGL02321:Ryr1 APN 7 29078696 missense probably damaging 1.00
IGL02448:Ryr1 APN 7 29105066 splice site probably benign
IGL02472:Ryr1 APN 7 29040844 missense probably damaging 1.00
IGL02544:Ryr1 APN 7 29115599 missense probably benign 0.24
IGL02666:Ryr1 APN 7 29019763 missense unknown
IGL02672:Ryr1 APN 7 29004519 unclassified probably benign
IGL02677:Ryr1 APN 7 29110608 missense probably benign 0.18
IGL02686:Ryr1 APN 7 29069550 splice site probably benign
IGL02751:Ryr1 APN 7 29078774 missense probably damaging 1.00
IGL02899:Ryr1 APN 7 29048795 missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 29061540 missense probably damaging 1.00
IGL02950:Ryr1 APN 7 29097459 missense probably damaging 1.00
IGL02960:Ryr1 APN 7 29060053 missense probably damaging 1.00
IGL02968:Ryr1 APN 7 29043893 missense probably damaging 1.00
IGL03070:Ryr1 APN 7 29070659 missense probably damaging 1.00
IGL03091:Ryr1 APN 7 29083486 missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 29104593 missense probably damaging 1.00
IGL03107:Ryr1 APN 7 29075199 missense probably damaging 1.00
IGL03117:Ryr1 APN 7 29102964 missense probably damaging 1.00
IGL03118:Ryr1 APN 7 29015786 missense unknown
IGL03146:Ryr1 APN 7 29094032 missense probably benign 0.09
IGL03165:Ryr1 APN 7 29105040 missense probably benign 0.22
IGL03220:Ryr1 APN 7 29059855 missense probably damaging 1.00
R0017:Ryr1 UTSW 7 29047542 missense probably damaging 1.00
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0069:Ryr1 UTSW 7 29110505 splice site probably benign
R0148:Ryr1 UTSW 7 29052035 missense probably damaging 0.99
R0266:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0346:Ryr1 UTSW 7 29067588 splice site probably benign
R0387:Ryr1 UTSW 7 29083367 splice site probably benign
R0454:Ryr1 UTSW 7 29036075 missense probably damaging 0.99
R0494:Ryr1 UTSW 7 29003793 splice site probably benign
R0533:Ryr1 UTSW 7 29078780 missense probably damaging 1.00
R0585:Ryr1 UTSW 7 29036076 missense probably damaging 1.00
R0591:Ryr1 UTSW 7 29104795 missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 29074609 missense probably damaging 1.00
R0662:Ryr1 UTSW 7 29100189 missense probably damaging 1.00
R0849:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0961:Ryr1 UTSW 7 29009697 missense unknown
R1052:Ryr1 UTSW 7 29096258 missense probably damaging 0.96
R1218:Ryr1 UTSW 7 29086109 missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 29116012 missense probably damaging 0.99
R1513:Ryr1 UTSW 7 29070621 missense probably damaging 1.00
R1543:Ryr1 UTSW 7 29083537 missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 29092175 missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 29062191 missense probably damaging 1.00
R1623:Ryr1 UTSW 7 29095490 missense probably damaging 1.00
R1632:Ryr1 UTSW 7 29094261 missense probably benign 0.03
R1661:Ryr1 UTSW 7 29101738 missense probably damaging 0.98
R1665:Ryr1 UTSW 7 29036078 missense probably damaging 1.00
R1678:Ryr1 UTSW 7 29116154 missense probably damaging 0.99
R1705:Ryr1 UTSW 7 29078564 missense probably damaging 1.00
R1712:Ryr1 UTSW 7 29047503 missense probably benign 0.25
R1720:Ryr1 UTSW 7 29101870 missense probably damaging 0.99
R1799:Ryr1 UTSW 7 29067621 missense probably damaging 1.00
R1847:Ryr1 UTSW 7 29079811 missense probably benign 0.43
R1860:Ryr1 UTSW 7 29009552 missense unknown
R1861:Ryr1 UTSW 7 29009552 missense unknown
R1921:Ryr1 UTSW 7 29054944 missense probably damaging 1.00
R1983:Ryr1 UTSW 7 29059472 missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 29059631 missense probably damaging 0.99
R2089:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2105:Ryr1 UTSW 7 29090150 missense probably damaging 0.99
R2175:Ryr1 UTSW 7 29068442 missense probably damaging 1.00
R2259:Ryr1 UTSW 7 29019741 missense unknown
R2291:Ryr1 UTSW 7 29098777 missense probably damaging 1.00
R2351:Ryr1 UTSW 7 29075293 missense probably benign 0.18
R2512:Ryr1 UTSW 7 29103542 missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 29009562 missense unknown
R2571:Ryr1 UTSW 7 29036126 missense possibly damaging 0.94
R2885:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2886:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2889:Ryr1 UTSW 7 29078741 missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3052:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3053:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3082:Ryr1 UTSW 7 29045646 missense probably damaging 1.00
R3103:Ryr1 UTSW 7 29074948 missense probably damaging 1.00
R3237:Ryr1 UTSW 7 29069650 critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3552:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3807:Ryr1 UTSW 7 29020152 missense probably damaging 1.00
R3815:Ryr1 UTSW 7 29072902 missense probably damaging 0.98
R4010:Ryr1 UTSW 7 29095124 missense probably benign 0.41
R4041:Ryr1 UTSW 7 29085931 missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 29062151 nonsense probably null
R4257:Ryr1 UTSW 7 29082450 missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 29083059 missense probably damaging 1.00
R4394:Ryr1 UTSW 7 29094242 missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 29090156 missense probably damaging 0.97
R4550:Ryr1 UTSW 7 29098735 missense probably benign 0.05
R4554:Ryr1 UTSW 7 29105008 missense probably benign 0.03
R4562:Ryr1 UTSW 7 29074580 intron probably benign
R4642:Ryr1 UTSW 7 29086038 missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 29059831 missense probably null 0.99
R4707:Ryr1 UTSW 7 29045662 missense probably damaging 1.00
R4766:Ryr1 UTSW 7 29085833 missense probably damaging 0.96
R4768:Ryr1 UTSW 7 29004821 unclassified probably benign
R4770:Ryr1 UTSW 7 29109282 missense probably damaging 0.99
R4780:Ryr1 UTSW 7 29095097 missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 29019983 missense unknown
R4933:Ryr1 UTSW 7 29104298 missense probably damaging 1.00
R4934:Ryr1 UTSW 7 29068095 missense probably damaging 1.00
R4942:Ryr1 UTSW 7 29069573 missense probably damaging 0.98
R4960:Ryr1 UTSW 7 29078783 missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 29069115 missense probably damaging 1.00
R5011:Ryr1 UTSW 7 29102809 splice site probably null
R5013:Ryr1 UTSW 7 29102809 splice site probably null
R5137:Ryr1 UTSW 7 29101858 missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 29067693 missense probably damaging 1.00
R5239:Ryr1 UTSW 7 29036128 missense probably damaging 1.00
R5291:Ryr1 UTSW 7 29115598 missense probably benign 0.03
R5303:Ryr1 UTSW 7 29068482 missense probably damaging 1.00
R5431:Ryr1 UTSW 7 29109812 missense probably benign 0.39
R5460:Ryr1 UTSW 7 29071961 missense probably damaging 1.00
R5463:Ryr1 UTSW 7 29024023 missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 29069028 missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 29086185 missense probably damaging 1.00
R5573:Ryr1 UTSW 7 29015723 missense unknown
R5575:Ryr1 UTSW 7 29078693 missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 29111974 missense probably benign 0.05
R5658:Ryr1 UTSW 7 29091089 splice site probably null
R5918:Ryr1 UTSW 7 29009152 missense probably benign 0.39
R5926:Ryr1 UTSW 7 29104360 missense probably damaging 1.00
R5938:Ryr1 UTSW 7 29046865 missense probably damaging 1.00
R5939:Ryr1 UTSW 7 29116127 missense probably damaging 0.97
R5947:Ryr1 UTSW 7 29071924 missense probably null 0.98
R5991:Ryr1 UTSW 7 29104610 missense probably damaging 0.99
R5992:Ryr1 UTSW 7 29067637 missense probably damaging 1.00
R5996:Ryr1 UTSW 7 29024241 missense probably benign 0.38
R6075:Ryr1 UTSW 7 29087438 missense probably damaging 1.00
R6091:Ryr1 UTSW 7 29071973 missense probably benign 0.01
R6126:Ryr1 UTSW 7 29076239 missense probably null 1.00
R6147:Ryr1 UTSW 7 29085914 missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 29116181 missense probably benign 0.07
R6279:Ryr1 UTSW 7 29087428 missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 29075257 missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 29059695 missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 29077078 missense probably damaging 0.97
R6459:Ryr1 UTSW 7 29015654 missense probably benign 0.39
R6514:Ryr1 UTSW 7 29046841 missense probably damaging 1.00
R6563:Ryr1 UTSW 7 29095492 missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 29038345 critical splice donor site probably null
R6746:Ryr1 UTSW 7 29117404 missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 29064874 missense probably benign 0.12
R6800:Ryr1 UTSW 7 29024316 missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 29052326 missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 29109387 missense probably benign 0.03
R6995:Ryr1 UTSW 7 29094182 missense probably damaging 0.97
R7065:Ryr1 UTSW 7 29103643 missense probably damaging 1.00
R7123:Ryr1 UTSW 7 29046854 missense probably benign 0.37
R7238:Ryr1 UTSW 7 29095382 missense probably benign 0.24
R7240:Ryr1 UTSW 7 29052015 missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 29059511 missense probably damaging 1.00
R7365:Ryr1 UTSW 7 29085755 missense probably benign 0.05
R7403:Ryr1 UTSW 7 29013867 missense probably benign 0.34
R7422:Ryr1 UTSW 7 29085870 missense probably benign 0.00
R7493:Ryr1 UTSW 7 29095205 missense probably benign 0.44
R7570:Ryr1 UTSW 7 29078585 missense probably damaging 0.98
R7593:Ryr1 UTSW 7 29036103 missense probably damaging 1.00
R7769:Ryr1 UTSW 7 29098785 missense probably damaging 1.00
R7781:Ryr1 UTSW 7 29067630 missense probably damaging 1.00
R7790:Ryr1 UTSW 7 29104832 missense probably benign 0.39
R7799:Ryr1 UTSW 7 29003560 splice site probably null
R7916:Ryr1 UTSW 7 29090939 nonsense probably null
R7922:Ryr1 UTSW 7 29097224 missense probably benign 0.09
R7988:Ryr1 UTSW 7 29096171 missense probably benign 0.29
R7997:Ryr1 UTSW 7 29003543 missense unknown
R8052:Ryr1 UTSW 7 29083385 missense probably benign 0.05
R8096:Ryr1 UTSW 7 29009201 missense unknown
R8116:Ryr1 UTSW 7 29110883 missense probably benign 0.03
R8202:Ryr1 UTSW 7 29091032 missense probably benign 0.18
R8207:Ryr1 UTSW 7 29090225 missense probably damaging 1.00
R8248:Ryr1 UTSW 7 29069121 missense probably damaging 1.00
R8257:Ryr1 UTSW 7 29064639 missense possibly damaging 0.82
R8354:Ryr1 UTSW 7 29015717 missense unknown
R8454:Ryr1 UTSW 7 29015717 missense unknown
R8487:Ryr1 UTSW 7 29040867 missense probably damaging 0.97
R8529:Ryr1 UTSW 7 29070084 missense possibly damaging 0.86
R8545:Ryr1 UTSW 7 29004814 unclassified probably benign
R8678:Ryr1 UTSW 7 29077064 missense probably damaging 0.99
R8717:Ryr1 UTSW 7 29052328 missense probably benign 0.03
R8724:Ryr1 UTSW 7 29117377 missense probably benign 0.04
R8755:Ryr1 UTSW 7 29092268 missense probably benign 0.19
R8772:Ryr1 UTSW 7 29116132 missense probably benign 0.05
R8790:Ryr1 UTSW 7 29076872 missense probably damaging 1.00
R8793:Ryr1 UTSW 7 29064859 missense probably damaging 1.00
R8836:Ryr1 UTSW 7 29074666 missense probably damaging 1.00
R8858:Ryr1 UTSW 7 29109213 missense probably benign 0.00
R8910:Ryr1 UTSW 7 29071915 missense probably damaging 1.00
R8920:Ryr1 UTSW 7 29090215 missense possibly damaging 0.89
R8938:Ryr1 UTSW 7 29101933 missense probably damaging 1.00
R9035:Ryr1 UTSW 7 29090997 missense probably damaging 0.97
R9115:Ryr1 UTSW 7 29104564 nonsense probably null
R9123:Ryr1 UTSW 7 29071804 missense probably damaging 1.00
R9154:Ryr1 UTSW 7 29069858 missense probably benign 0.08
R9189:Ryr1 UTSW 7 29077046 missense probably damaging 1.00
R9200:Ryr1 UTSW 7 29095099 missense probably benign 0.00
R9214:Ryr1 UTSW 7 29085762 missense possibly damaging 0.52
R9216:Ryr1 UTSW 7 29101852 missense probably damaging 0.97
R9240:Ryr1 UTSW 7 29043888 missense probably damaging 1.00
R9261:Ryr1 UTSW 7 29052388 missense possibly damaging 0.91
R9276:Ryr1 UTSW 7 29102829 missense probably damaging 0.99
R9280:Ryr1 UTSW 7 29102964 missense probably damaging 1.00
R9316:Ryr1 UTSW 7 29017962 missense unknown
R9333:Ryr1 UTSW 7 29074789 critical splice donor site probably null
R9459:Ryr1 UTSW 7 29068643 missense probably damaging 1.00
R9468:Ryr1 UTSW 7 29073085 missense probably damaging 1.00
R9486:Ryr1 UTSW 7 29078540 missense probably benign 0.15
R9524:Ryr1 UTSW 7 29024175 missense probably damaging 1.00
R9620:Ryr1 UTSW 7 29015713 missense unknown
R9664:Ryr1 UTSW 7 29059667 missense probably damaging 1.00
R9776:Ryr1 UTSW 7 29075239 missense probably damaging 1.00
X0021:Ryr1 UTSW 7 29061531 missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29020214 missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29086035 missense probably benign 0.10
Z1176:Ryr1 UTSW 7 29103498 missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 29017985 missense unknown
Z1177:Ryr1 UTSW 7 29048792 nonsense probably null
Z1177:Ryr1 UTSW 7 29101922 missense probably damaging 1.00
Z1186:Ryr1 UTSW 7 29082477 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CCCACTTATCCAAATTGAGGGCC -3'
(R):5'- TCCTGTGTTGTTGGCAAAGC -3'

Sequencing Primer
(F):5'- ATCCAAATTGAGGGCCTGTGG -3'
(R):5'- CAAAGCTTTGATGTGTGTGATGCC -3'
Posted On 2016-08-04