Incidental Mutation 'R5386:Stx1b'
ID 425225
Institutional Source Beutler Lab
Gene Symbol Stx1b
Ensembl Gene ENSMUSG00000030806
Gene Name syntaxin 1B
Synonyms Stx1b2
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.324) question?
Stock # R5386 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 127403072-127423703 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127414575 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 16 (D16E)
Ref Sequence ENSEMBL: ENSMUSP00000101874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106267] [ENSMUST00000156135]
AlphaFold P61264
Predicted Effect probably benign
Transcript: ENSMUST00000106267
AA Change: D16E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101874
Gene: ENSMUSG00000030806
AA Change: D16E

DomainStartEndE-ValueType
SynN 24 145 1.99e-44 SMART
t_SNARE 186 253 4.32e-24 SMART
transmembrane domain 265 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206297
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins thought to play a role in the exocytosis of synaptic vesicles. Vesicle exocytosis releases vesicular contents and is important to various cellular functions. For instance, the secretion of transmitters from neurons plays an important role in synaptic transmission. After exocytosis, the membrane and proteins from the vesicle are retrieved from the plasma membrane through the process of endocytosis. Mutations in this gene have been identified as one cause of fever-associated epilepsy syndromes. A possible link between this gene and Parkinson's disease has also been suggested. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele that encodes an 'open' syntaxin-1B protein conformation are viable but display severe ataxia, reduced chromaffin vesicle docking, accelerated synaptic vesicle fusion, and lethal epileptic seizures after 2 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T G 8: 87,244,118 (GRCm39) K1012Q possibly damaging Het
Afmid G A 11: 117,718,968 (GRCm39) G33R probably benign Het
Agbl3 G T 6: 34,776,131 (GRCm39) W207C probably damaging Het
Ajuba T C 14: 54,807,855 (GRCm39) Y459C probably damaging Het
Ak2 T C 4: 128,901,965 (GRCm39) S213P probably benign Het
Alk T A 17: 72,182,007 (GRCm39) N1339Y probably damaging Het
Angpt1 T C 15: 42,301,761 (GRCm39) S416G probably damaging Het
Ank2 C T 3: 126,775,582 (GRCm39) V854M probably benign Het
Ankrd61 G T 5: 143,828,482 (GRCm39) N122K possibly damaging Het
Armc9 T A 1: 86,126,011 (GRCm39) L34Q probably null Het
Aspg T A 12: 112,089,466 (GRCm39) V418E probably benign Het
Baz1b C T 5: 135,266,913 (GRCm39) R1241C probably damaging Het
Bclaf1 T C 10: 20,201,338 (GRCm39) V201A possibly damaging Het
C1ql3 A T 2: 13,009,169 (GRCm39) D225E probably damaging Het
Capn9 A G 8: 125,332,279 (GRCm39) T417A possibly damaging Het
Card14 C T 11: 119,208,115 (GRCm39) R62C probably damaging Het
Cc2d2a A G 5: 43,887,383 (GRCm39) N1271S probably benign Het
Ccpg1 G A 9: 72,920,326 (GRCm39) S647N probably benign Het
Cdv3 T C 9: 103,232,429 (GRCm39) K133R possibly damaging Het
Cep128 A C 12: 90,966,345 (GRCm39) S1087R probably benign Het
Cep70 T A 9: 99,163,128 (GRCm39) L325Q probably damaging Het
Chit1 T G 1: 134,077,192 (GRCm39) F332V probably damaging Het
Chodl C A 16: 78,743,585 (GRCm39) T219K probably damaging Het
Cntn4 T C 6: 106,158,765 (GRCm39) L10P possibly damaging Het
Copg1 G T 6: 87,867,189 (GRCm39) M87I possibly damaging Het
Cplane1 G A 15: 8,223,897 (GRCm39) G887R probably damaging Het
Cyp3a59 A G 5: 146,022,578 (GRCm39) Y28C probably benign Het
Dchs1 A C 7: 105,407,236 (GRCm39) V2119G probably damaging Het
Dedd T C 1: 171,165,951 (GRCm39) L23P probably damaging Het
Dmxl2 A G 9: 54,286,041 (GRCm39) S2715P probably benign Het
Dnah9 T C 11: 65,920,182 (GRCm39) N2237S probably damaging Het
Drosha A G 15: 12,842,207 (GRCm39) I337V probably benign Het
Duox2 A G 2: 122,125,617 (GRCm39) V330A probably benign Het
Dusp11 T C 6: 85,924,587 (GRCm39) *322W probably null Het
Dusp8 T A 7: 141,643,730 (GRCm39) Q61L possibly damaging Het
Ears2 G C 7: 121,643,600 (GRCm39) T426S probably benign Het
Elmo1 T C 13: 20,784,380 (GRCm39) Y646H probably benign Het
Eps15 T A 4: 109,178,422 (GRCm39) I220K possibly damaging Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Fam171a2 C A 11: 102,328,693 (GRCm39) V689L possibly damaging Het
Fam91a1 G A 15: 58,320,243 (GRCm39) S645N probably benign Het
Fancg G A 4: 43,007,076 (GRCm39) Q234* probably null Het
Garre1 A G 7: 33,941,813 (GRCm39) F120L probably damaging Het
Gid4 T A 11: 60,323,268 (GRCm39) probably null Het
Gm7361 A C 5: 26,463,903 (GRCm39) T53P probably benign Het
Golgb1 T A 16: 36,732,677 (GRCm39) C641* probably null Het
Gon4l T A 3: 88,765,803 (GRCm39) M409K probably benign Het
Gpatch8 A T 11: 102,399,053 (GRCm39) probably null Het
Gpr156 T A 16: 37,768,671 (GRCm39) V64E possibly damaging Het
Grid2 T A 6: 63,908,089 (GRCm39) I243K probably damaging Het
Gucy2g G A 19: 55,203,548 (GRCm39) A750V probably damaging Het
Hdac5 T C 11: 102,092,967 (GRCm39) E590G possibly damaging Het
Herc3 T A 6: 58,851,263 (GRCm39) M504K probably damaging Het
Hif1a A G 12: 73,990,867 (GRCm39) E713G probably benign Het
Hmx3 A G 7: 131,146,033 (GRCm39) D247G probably damaging Het
Hoxd11 G T 2: 74,513,163 (GRCm39) E143* probably null Het
Ifitm3 T C 7: 140,590,554 (GRCm39) N2S probably benign Het
Il17f T C 1: 20,848,181 (GRCm39) Q99R probably benign Het
Itga6 T A 2: 71,671,494 (GRCm39) S341R probably damaging Het
Itgam A G 7: 127,707,152 (GRCm39) N661S probably benign Het
Jag1 A T 2: 136,937,464 (GRCm39) H303Q possibly damaging Het
Kcnh8 T A 17: 53,033,023 (GRCm39) N103K probably benign Het
Kdm6b T C 11: 69,291,636 (GRCm39) probably benign Het
Keg1 A C 19: 12,691,902 (GRCm39) N63T probably damaging Het
Klf12 T A 14: 100,137,595 (GRCm39) H317L probably damaging Het
Lrp1 A T 10: 127,427,983 (GRCm39) V530E probably damaging Het
Mrgpra6 A G 7: 46,838,629 (GRCm39) C190R probably damaging Het
Myo1a G T 10: 127,541,766 (GRCm39) E102* probably null Het
Napa A T 7: 15,850,397 (GRCm39) E265D probably benign Het
Ncam1 A C 9: 49,476,174 (GRCm39) V305G probably damaging Het
Nek8 T C 11: 78,061,263 (GRCm39) probably null Het
Or10ag53 C T 2: 87,082,827 (GRCm39) P182L probably benign Het
Or11g24 T A 14: 50,662,846 (GRCm39) V290E possibly damaging Het
Or4a70 G T 2: 89,324,481 (GRCm39) Y58* probably null Het
Or4f52 T C 2: 111,061,539 (GRCm39) T200A probably benign Het
Or52a20 T C 7: 103,366,562 (GRCm39) F254L probably benign Het
Or5ak4 T C 2: 85,161,979 (GRCm39) T88A probably benign Het
Or5h23 T A 16: 58,906,253 (GRCm39) M198L probably benign Het
Or8c11 A T 9: 38,289,281 (GRCm39) I29F probably benign Het
Or8g2b A G 9: 39,751,126 (GRCm39) Y132C possibly damaging Het
Pabpc4 A G 4: 123,188,790 (GRCm39) Q417R probably benign Het
Panx3 A T 9: 37,580,320 (GRCm39) M11K probably damaging Het
Pcbp1 C T 6: 86,502,471 (GRCm39) E143K probably damaging Het
Pdcd7 G A 9: 65,265,974 (GRCm39) W477* probably null Het
Pi4k2a G A 19: 42,078,954 (GRCm39) S5N probably damaging Het
Plag1 T A 4: 3,904,075 (GRCm39) Q372L probably benign Het
Plce1 C A 19: 38,748,535 (GRCm39) N1755K probably damaging Het
Pld4 G T 12: 112,730,422 (GRCm39) E102* probably null Het
Pnlip A G 19: 58,668,039 (GRCm39) N345S probably benign Het
Ppm1e A T 11: 87,249,377 (GRCm39) L118Q possibly damaging Het
Prkra T G 2: 76,469,622 (GRCm39) T146P probably damaging Het
Prpf8 A G 11: 75,386,625 (GRCm39) D1038G probably damaging Het
Prss51 T A 14: 64,334,543 (GRCm39) V108E probably damaging Het
Prxl2b T A 4: 154,983,462 (GRCm39) M1L probably benign Het
Ptch1 A G 13: 63,692,857 (GRCm39) Y181H probably damaging Het
Reln A G 5: 22,244,527 (GRCm39) V817A probably benign Het
Rictor C A 15: 6,818,985 (GRCm39) Q1403K probably benign Het
Rims1 T A 1: 22,482,469 (GRCm39) I882F probably damaging Het
Rnf19a A G 15: 36,242,185 (GRCm39) V618A probably benign Het
Ryr1 A T 7: 28,816,841 (GRCm39) I65N probably damaging Het
S1pr2 T C 9: 20,878,890 (GRCm39) T313A probably benign Het
Serpine2 A T 1: 79,799,004 (GRCm39) Y83* probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,103,384 (GRCm39) probably benign Het
Sgip1 T C 4: 102,772,256 (GRCm39) V215A probably benign Het
Sgsm3 T C 15: 80,892,200 (GRCm39) V256A probably benign Het
Shroom4 T A X: 6,497,523 (GRCm39) C894* probably null Het
Slc14a2 T A 18: 78,229,055 (GRCm39) D306V possibly damaging Het
Slc28a2b C A 2: 122,353,259 (GRCm39) L480I probably benign Het
Slc4a10 A T 2: 62,120,402 (GRCm39) E843V probably damaging Het
Smyd4 T A 11: 75,280,982 (GRCm39) C152S probably damaging Het
Snx10 T C 6: 51,552,952 (GRCm39) Y32H probably damaging Het
Sorl1 T C 9: 41,968,580 (GRCm39) T558A possibly damaging Het
Spata31d1b G A 13: 59,866,866 (GRCm39) C1338Y possibly damaging Het
Sppl2c T A 11: 104,078,127 (GRCm39) I309K possibly damaging Het
Stard9 A G 2: 120,531,111 (GRCm39) E2456G probably damaging Het
Tecpr2 T C 12: 110,881,887 (GRCm39) V152A probably damaging Het
Tedc1 T C 12: 113,120,302 (GRCm39) V47A probably benign Het
Tep1 A T 14: 51,105,774 (GRCm39) L82Q probably damaging Het
Tgm4 A G 9: 122,885,559 (GRCm39) Y367C probably damaging Het
Tle1 C T 4: 72,060,081 (GRCm39) V258M probably damaging Het
Tm9sf1 C T 14: 55,880,301 (GRCm39) G32D possibly damaging Het
Tmco2 A G 4: 120,963,181 (GRCm39) L106P probably damaging Het
Tmem131 A T 1: 36,911,639 (GRCm39) C103S possibly damaging Het
Tmprss7 T A 16: 45,489,891 (GRCm39) I444F possibly damaging Het
Trank1 T C 9: 111,191,470 (GRCm39) V493A probably benign Het
Trim80 A T 11: 115,338,843 (GRCm39) T558S probably benign Het
Trmt6 C A 2: 132,650,703 (GRCm39) A302S probably benign Het
Ttc17 A T 2: 94,133,985 (GRCm39) W1067R probably damaging Het
Tulp4 T A 17: 6,286,568 (GRCm39) V1532D probably damaging Het
Ubqlnl T G 7: 103,798,424 (GRCm39) I358L probably benign Het
Ulk3 T A 9: 57,498,023 (GRCm39) I108N possibly damaging Het
Vps13b A T 15: 35,640,674 (GRCm39) probably null Het
Vwa3a A G 7: 120,389,365 (GRCm39) K68E possibly damaging Het
Zfp746 G T 6: 48,041,110 (GRCm39) H538N possibly damaging Het
Other mutations in Stx1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Stx1b APN 7 127,409,870 (GRCm39) missense probably damaging 1.00
IGL02730:Stx1b APN 7 127,414,549 (GRCm39) missense probably benign 0.37
IGL03394:Stx1b APN 7 127,407,056 (GRCm39) missense probably damaging 1.00
R0680:Stx1b UTSW 7 127,406,895 (GRCm39) missense possibly damaging 0.80
R1141:Stx1b UTSW 7 127,410,098 (GRCm39) splice site probably null
R1511:Stx1b UTSW 7 127,414,144 (GRCm39) missense probably damaging 0.99
R2024:Stx1b UTSW 7 127,414,575 (GRCm39) missense probably benign 0.00
R2116:Stx1b UTSW 7 127,410,077 (GRCm39) missense probably damaging 1.00
R4964:Stx1b UTSW 7 127,407,093 (GRCm39) missense probably damaging 1.00
R4966:Stx1b UTSW 7 127,407,093 (GRCm39) missense probably damaging 1.00
R5385:Stx1b UTSW 7 127,414,575 (GRCm39) missense probably benign 0.00
R5777:Stx1b UTSW 7 127,410,090 (GRCm39) nonsense probably null
R6092:Stx1b UTSW 7 127,407,035 (GRCm39) missense possibly damaging 0.94
R6184:Stx1b UTSW 7 127,407,077 (GRCm39) missense possibly damaging 0.79
R6688:Stx1b UTSW 7 127,407,068 (GRCm39) missense probably damaging 1.00
R6843:Stx1b UTSW 7 127,414,151 (GRCm39) nonsense probably null
R7493:Stx1b UTSW 7 127,406,531 (GRCm39) missense possibly damaging 0.88
R7919:Stx1b UTSW 7 127,406,507 (GRCm39) missense probably benign 0.19
R8401:Stx1b UTSW 7 127,406,945 (GRCm39) splice site probably benign
R9164:Stx1b UTSW 7 127,414,159 (GRCm39) missense probably benign
R9608:Stx1b UTSW 7 127,406,551 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTTCAGTGAAATCGGCCAAAC -3'
(R):5'- TGGTCTACAAGGTATCCAGTGC -3'

Sequencing Primer
(F):5'- GCCAAACCGTGAAGGCC -3'
(R):5'- AGTGTTGGTGACCTTGCCATC -3'
Posted On 2016-08-04