Incidental Mutation 'R5386:Sorl1'
ID 425236
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Name sortilin-related receptor, LDLR class A repeats-containing
Synonyms Sorla, mSorLA, LR11, 2900010L19Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.319) question?
Stock # R5386 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 41876016-42035593 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41968580 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 558 (T558A)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
AlphaFold O88307
Predicted Effect possibly damaging
Transcript: ENSMUST00000060989
AA Change: T558A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: T558A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T G 8: 87,244,118 (GRCm39) K1012Q possibly damaging Het
Afmid G A 11: 117,718,968 (GRCm39) G33R probably benign Het
Agbl3 G T 6: 34,776,131 (GRCm39) W207C probably damaging Het
Ajuba T C 14: 54,807,855 (GRCm39) Y459C probably damaging Het
Ak2 T C 4: 128,901,965 (GRCm39) S213P probably benign Het
Alk T A 17: 72,182,007 (GRCm39) N1339Y probably damaging Het
Angpt1 T C 15: 42,301,761 (GRCm39) S416G probably damaging Het
Ank2 C T 3: 126,775,582 (GRCm39) V854M probably benign Het
Ankrd61 G T 5: 143,828,482 (GRCm39) N122K possibly damaging Het
Armc9 T A 1: 86,126,011 (GRCm39) L34Q probably null Het
Aspg T A 12: 112,089,466 (GRCm39) V418E probably benign Het
Baz1b C T 5: 135,266,913 (GRCm39) R1241C probably damaging Het
Bclaf1 T C 10: 20,201,338 (GRCm39) V201A possibly damaging Het
C1ql3 A T 2: 13,009,169 (GRCm39) D225E probably damaging Het
Capn9 A G 8: 125,332,279 (GRCm39) T417A possibly damaging Het
Card14 C T 11: 119,208,115 (GRCm39) R62C probably damaging Het
Cc2d2a A G 5: 43,887,383 (GRCm39) N1271S probably benign Het
Ccpg1 G A 9: 72,920,326 (GRCm39) S647N probably benign Het
Cdv3 T C 9: 103,232,429 (GRCm39) K133R possibly damaging Het
Cep128 A C 12: 90,966,345 (GRCm39) S1087R probably benign Het
Cep70 T A 9: 99,163,128 (GRCm39) L325Q probably damaging Het
Chit1 T G 1: 134,077,192 (GRCm39) F332V probably damaging Het
Chodl C A 16: 78,743,585 (GRCm39) T219K probably damaging Het
Cntn4 T C 6: 106,158,765 (GRCm39) L10P possibly damaging Het
Copg1 G T 6: 87,867,189 (GRCm39) M87I possibly damaging Het
Cplane1 G A 15: 8,223,897 (GRCm39) G887R probably damaging Het
Cyp3a59 A G 5: 146,022,578 (GRCm39) Y28C probably benign Het
Dchs1 A C 7: 105,407,236 (GRCm39) V2119G probably damaging Het
Dedd T C 1: 171,165,951 (GRCm39) L23P probably damaging Het
Dmxl2 A G 9: 54,286,041 (GRCm39) S2715P probably benign Het
Dnah9 T C 11: 65,920,182 (GRCm39) N2237S probably damaging Het
Drosha A G 15: 12,842,207 (GRCm39) I337V probably benign Het
Duox2 A G 2: 122,125,617 (GRCm39) V330A probably benign Het
Dusp11 T C 6: 85,924,587 (GRCm39) *322W probably null Het
Dusp8 T A 7: 141,643,730 (GRCm39) Q61L possibly damaging Het
Ears2 G C 7: 121,643,600 (GRCm39) T426S probably benign Het
Elmo1 T C 13: 20,784,380 (GRCm39) Y646H probably benign Het
Eps15 T A 4: 109,178,422 (GRCm39) I220K possibly damaging Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Fam171a2 C A 11: 102,328,693 (GRCm39) V689L possibly damaging Het
Fam91a1 G A 15: 58,320,243 (GRCm39) S645N probably benign Het
Fancg G A 4: 43,007,076 (GRCm39) Q234* probably null Het
Garre1 A G 7: 33,941,813 (GRCm39) F120L probably damaging Het
Gid4 T A 11: 60,323,268 (GRCm39) probably null Het
Gm7361 A C 5: 26,463,903 (GRCm39) T53P probably benign Het
Golgb1 T A 16: 36,732,677 (GRCm39) C641* probably null Het
Gon4l T A 3: 88,765,803 (GRCm39) M409K probably benign Het
Gpatch8 A T 11: 102,399,053 (GRCm39) probably null Het
Gpr156 T A 16: 37,768,671 (GRCm39) V64E possibly damaging Het
Grid2 T A 6: 63,908,089 (GRCm39) I243K probably damaging Het
Gucy2g G A 19: 55,203,548 (GRCm39) A750V probably damaging Het
Hdac5 T C 11: 102,092,967 (GRCm39) E590G possibly damaging Het
Herc3 T A 6: 58,851,263 (GRCm39) M504K probably damaging Het
Hif1a A G 12: 73,990,867 (GRCm39) E713G probably benign Het
Hmx3 A G 7: 131,146,033 (GRCm39) D247G probably damaging Het
Hoxd11 G T 2: 74,513,163 (GRCm39) E143* probably null Het
Ifitm3 T C 7: 140,590,554 (GRCm39) N2S probably benign Het
Il17f T C 1: 20,848,181 (GRCm39) Q99R probably benign Het
Itga6 T A 2: 71,671,494 (GRCm39) S341R probably damaging Het
Itgam A G 7: 127,707,152 (GRCm39) N661S probably benign Het
Jag1 A T 2: 136,937,464 (GRCm39) H303Q possibly damaging Het
Kcnh8 T A 17: 53,033,023 (GRCm39) N103K probably benign Het
Kdm6b T C 11: 69,291,636 (GRCm39) probably benign Het
Keg1 A C 19: 12,691,902 (GRCm39) N63T probably damaging Het
Klf12 T A 14: 100,137,595 (GRCm39) H317L probably damaging Het
Lrp1 A T 10: 127,427,983 (GRCm39) V530E probably damaging Het
Mrgpra6 A G 7: 46,838,629 (GRCm39) C190R probably damaging Het
Myo1a G T 10: 127,541,766 (GRCm39) E102* probably null Het
Napa A T 7: 15,850,397 (GRCm39) E265D probably benign Het
Ncam1 A C 9: 49,476,174 (GRCm39) V305G probably damaging Het
Nek8 T C 11: 78,061,263 (GRCm39) probably null Het
Or10ag53 C T 2: 87,082,827 (GRCm39) P182L probably benign Het
Or11g24 T A 14: 50,662,846 (GRCm39) V290E possibly damaging Het
Or4a70 G T 2: 89,324,481 (GRCm39) Y58* probably null Het
Or4f52 T C 2: 111,061,539 (GRCm39) T200A probably benign Het
Or52a20 T C 7: 103,366,562 (GRCm39) F254L probably benign Het
Or5ak4 T C 2: 85,161,979 (GRCm39) T88A probably benign Het
Or5h23 T A 16: 58,906,253 (GRCm39) M198L probably benign Het
Or8c11 A T 9: 38,289,281 (GRCm39) I29F probably benign Het
Or8g2b A G 9: 39,751,126 (GRCm39) Y132C possibly damaging Het
Pabpc4 A G 4: 123,188,790 (GRCm39) Q417R probably benign Het
Panx3 A T 9: 37,580,320 (GRCm39) M11K probably damaging Het
Pcbp1 C T 6: 86,502,471 (GRCm39) E143K probably damaging Het
Pdcd7 G A 9: 65,265,974 (GRCm39) W477* probably null Het
Pi4k2a G A 19: 42,078,954 (GRCm39) S5N probably damaging Het
Plag1 T A 4: 3,904,075 (GRCm39) Q372L probably benign Het
Plce1 C A 19: 38,748,535 (GRCm39) N1755K probably damaging Het
Pld4 G T 12: 112,730,422 (GRCm39) E102* probably null Het
Pnlip A G 19: 58,668,039 (GRCm39) N345S probably benign Het
Ppm1e A T 11: 87,249,377 (GRCm39) L118Q possibly damaging Het
Prkra T G 2: 76,469,622 (GRCm39) T146P probably damaging Het
Prpf8 A G 11: 75,386,625 (GRCm39) D1038G probably damaging Het
Prss51 T A 14: 64,334,543 (GRCm39) V108E probably damaging Het
Prxl2b T A 4: 154,983,462 (GRCm39) M1L probably benign Het
Ptch1 A G 13: 63,692,857 (GRCm39) Y181H probably damaging Het
Reln A G 5: 22,244,527 (GRCm39) V817A probably benign Het
Rictor C A 15: 6,818,985 (GRCm39) Q1403K probably benign Het
Rims1 T A 1: 22,482,469 (GRCm39) I882F probably damaging Het
Rnf19a A G 15: 36,242,185 (GRCm39) V618A probably benign Het
Ryr1 A T 7: 28,816,841 (GRCm39) I65N probably damaging Het
S1pr2 T C 9: 20,878,890 (GRCm39) T313A probably benign Het
Serpine2 A T 1: 79,799,004 (GRCm39) Y83* probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,103,384 (GRCm39) probably benign Het
Sgip1 T C 4: 102,772,256 (GRCm39) V215A probably benign Het
Sgsm3 T C 15: 80,892,200 (GRCm39) V256A probably benign Het
Shroom4 T A X: 6,497,523 (GRCm39) C894* probably null Het
Slc14a2 T A 18: 78,229,055 (GRCm39) D306V possibly damaging Het
Slc28a2b C A 2: 122,353,259 (GRCm39) L480I probably benign Het
Slc4a10 A T 2: 62,120,402 (GRCm39) E843V probably damaging Het
Smyd4 T A 11: 75,280,982 (GRCm39) C152S probably damaging Het
Snx10 T C 6: 51,552,952 (GRCm39) Y32H probably damaging Het
Spata31d1b G A 13: 59,866,866 (GRCm39) C1338Y possibly damaging Het
Sppl2c T A 11: 104,078,127 (GRCm39) I309K possibly damaging Het
Stard9 A G 2: 120,531,111 (GRCm39) E2456G probably damaging Het
Stx1b A T 7: 127,414,575 (GRCm39) D16E probably benign Het
Tecpr2 T C 12: 110,881,887 (GRCm39) V152A probably damaging Het
Tedc1 T C 12: 113,120,302 (GRCm39) V47A probably benign Het
Tep1 A T 14: 51,105,774 (GRCm39) L82Q probably damaging Het
Tgm4 A G 9: 122,885,559 (GRCm39) Y367C probably damaging Het
Tle1 C T 4: 72,060,081 (GRCm39) V258M probably damaging Het
Tm9sf1 C T 14: 55,880,301 (GRCm39) G32D possibly damaging Het
Tmco2 A G 4: 120,963,181 (GRCm39) L106P probably damaging Het
Tmem131 A T 1: 36,911,639 (GRCm39) C103S possibly damaging Het
Tmprss7 T A 16: 45,489,891 (GRCm39) I444F possibly damaging Het
Trank1 T C 9: 111,191,470 (GRCm39) V493A probably benign Het
Trim80 A T 11: 115,338,843 (GRCm39) T558S probably benign Het
Trmt6 C A 2: 132,650,703 (GRCm39) A302S probably benign Het
Ttc17 A T 2: 94,133,985 (GRCm39) W1067R probably damaging Het
Tulp4 T A 17: 6,286,568 (GRCm39) V1532D probably damaging Het
Ubqlnl T G 7: 103,798,424 (GRCm39) I358L probably benign Het
Ulk3 T A 9: 57,498,023 (GRCm39) I108N possibly damaging Het
Vps13b A T 15: 35,640,674 (GRCm39) probably null Het
Vwa3a A G 7: 120,389,365 (GRCm39) K68E possibly damaging Het
Zfp746 G T 6: 48,041,110 (GRCm39) H538N possibly damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41,885,390 (GRCm39) missense probably damaging 1.00
IGL01303:Sorl1 APN 9 41,935,774 (GRCm39) splice site probably benign
IGL01545:Sorl1 APN 9 41,955,252 (GRCm39) missense probably damaging 1.00
IGL01629:Sorl1 APN 9 41,968,565 (GRCm39) critical splice donor site probably null
IGL01670:Sorl1 APN 9 41,912,788 (GRCm39) missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41,892,007 (GRCm39) missense probably damaging 0.96
IGL02154:Sorl1 APN 9 41,915,330 (GRCm39) missense probably benign
IGL02215:Sorl1 APN 9 41,929,478 (GRCm39) missense probably damaging 0.97
IGL02427:Sorl1 APN 9 41,952,986 (GRCm39) missense probably damaging 1.00
IGL02590:Sorl1 APN 9 41,957,857 (GRCm39) missense probably benign 0.01
IGL02794:Sorl1 APN 9 41,975,070 (GRCm39) missense probably damaging 0.98
IGL02797:Sorl1 APN 9 41,948,355 (GRCm39) missense probably damaging 0.99
IGL02987:Sorl1 APN 9 41,952,349 (GRCm39) missense probably damaging 1.00
IGL03005:Sorl1 APN 9 41,968,621 (GRCm39) missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41,902,722 (GRCm39) missense probably benign
IGL03288:Sorl1 APN 9 41,944,858 (GRCm39) splice site probably benign
N/A - 287:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
PIT4151001:Sorl1 UTSW 9 41,879,918 (GRCm39) missense probably damaging 1.00
R0117:Sorl1 UTSW 9 41,944,873 (GRCm39) missense probably benign 0.10
R0173:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R0318:Sorl1 UTSW 9 41,993,250 (GRCm39) missense probably damaging 1.00
R0385:Sorl1 UTSW 9 41,943,205 (GRCm39) missense probably damaging 0.99
R0448:Sorl1 UTSW 9 41,915,384 (GRCm39) missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41,902,667 (GRCm39) missense probably null 0.00
R0512:Sorl1 UTSW 9 41,979,128 (GRCm39) missense probably benign 0.01
R0587:Sorl1 UTSW 9 41,895,802 (GRCm39) missense probably damaging 1.00
R0600:Sorl1 UTSW 9 41,955,196 (GRCm39) splice site probably benign
R0831:Sorl1 UTSW 9 41,982,365 (GRCm39) splice site probably benign
R0924:Sorl1 UTSW 9 41,919,470 (GRCm39) splice site probably benign
R1013:Sorl1 UTSW 9 41,913,855 (GRCm39) missense probably benign 0.00
R1053:Sorl1 UTSW 9 41,902,752 (GRCm39) missense probably benign
R1077:Sorl1 UTSW 9 41,925,786 (GRCm39) missense probably damaging 1.00
R1326:Sorl1 UTSW 9 41,943,092 (GRCm39) missense probably benign 0.14
R1348:Sorl1 UTSW 9 41,911,708 (GRCm39) splice site probably null
R1498:Sorl1 UTSW 9 41,952,369 (GRCm39) missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41,885,296 (GRCm39) missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41,907,538 (GRCm39) missense probably benign 0.06
R1738:Sorl1 UTSW 9 42,001,261 (GRCm39) missense probably benign 0.33
R1779:Sorl1 UTSW 9 41,902,778 (GRCm39) critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41,881,021 (GRCm39) nonsense probably null
R1912:Sorl1 UTSW 9 41,993,246 (GRCm39) missense probably damaging 1.00
R1952:Sorl1 UTSW 9 41,957,920 (GRCm39) missense probably benign
R2071:Sorl1 UTSW 9 41,890,753 (GRCm39) missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41,895,788 (GRCm39) missense probably benign 0.01
R2417:Sorl1 UTSW 9 41,892,007 (GRCm39) missense probably damaging 0.96
R2429:Sorl1 UTSW 9 41,948,366 (GRCm39) missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41,881,077 (GRCm39) missense probably benign
R3815:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 41,915,401 (GRCm39) missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41,900,764 (GRCm39) critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 41,946,744 (GRCm39) missense probably damaging 0.99
R4410:Sorl1 UTSW 9 41,915,288 (GRCm39) nonsense probably null
R4610:Sorl1 UTSW 9 41,943,210 (GRCm39) missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 41,915,347 (GRCm39) missense probably damaging 0.97
R4666:Sorl1 UTSW 9 41,915,347 (GRCm39) missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41,895,804 (GRCm39) missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41,903,617 (GRCm39) missense probably damaging 1.00
R4874:Sorl1 UTSW 9 41,975,048 (GRCm39) missense probably damaging 0.99
R4898:Sorl1 UTSW 9 41,952,935 (GRCm39) missense probably damaging 1.00
R4922:Sorl1 UTSW 9 41,925,746 (GRCm39) splice site probably null
R4976:Sorl1 UTSW 9 41,894,299 (GRCm39) missense probably benign 0.00
R4984:Sorl1 UTSW 9 41,902,638 (GRCm39) missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R5070:Sorl1 UTSW 9 41,943,114 (GRCm39) missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41,887,673 (GRCm39) missense probably benign 0.01
R5202:Sorl1 UTSW 9 41,944,879 (GRCm39) missense probably benign 0.00
R5265:Sorl1 UTSW 9 42,017,812 (GRCm39) missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 41,942,198 (GRCm39) missense probably benign 0.33
R5368:Sorl1 UTSW 9 41,890,686 (GRCm39) missense probably benign 0.00
R5385:Sorl1 UTSW 9 41,968,580 (GRCm39) missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 41,913,932 (GRCm39) nonsense probably null
R5518:Sorl1 UTSW 9 41,948,508 (GRCm39) missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41,902,921 (GRCm39) missense probably benign 0.08
R5864:Sorl1 UTSW 9 42,003,669 (GRCm39) missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41,894,330 (GRCm39) missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41,881,038 (GRCm39) missense probably benign 0.10
R6484:Sorl1 UTSW 9 41,887,703 (GRCm39) missense probably damaging 1.00
R6505:Sorl1 UTSW 9 41,982,530 (GRCm39) missense probably damaging 1.00
R6591:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6596:Sorl1 UTSW 9 41,912,899 (GRCm39) missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41,891,941 (GRCm39) missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6702:Sorl1 UTSW 9 41,982,497 (GRCm39) missense probably damaging 0.97
R6703:Sorl1 UTSW 9 41,982,497 (GRCm39) missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42,003,748 (GRCm39) missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42,010,559 (GRCm39) missense probably damaging 1.00
R6852:Sorl1 UTSW 9 41,935,694 (GRCm39) missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 41,933,688 (GRCm39) missense probably benign 0.01
R6925:Sorl1 UTSW 9 41,944,922 (GRCm39) missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41,881,047 (GRCm39) missense probably benign 0.11
R7033:Sorl1 UTSW 9 41,942,279 (GRCm39) missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 41,913,930 (GRCm39) missense probably benign 0.00
R7267:Sorl1 UTSW 9 42,035,375 (GRCm39) missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 41,948,499 (GRCm39) missense probably damaging 0.99
R7272:Sorl1 UTSW 9 41,975,006 (GRCm39) splice site probably null
R7537:Sorl1 UTSW 9 41,891,984 (GRCm39) missense probably benign 0.01
R7615:Sorl1 UTSW 9 41,888,878 (GRCm39) missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42,003,630 (GRCm39) missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41,895,822 (GRCm39) missense probably damaging 1.00
R7763:Sorl1 UTSW 9 41,955,205 (GRCm39) missense probably damaging 1.00
R7831:Sorl1 UTSW 9 42,001,257 (GRCm39) missense probably benign 0.17
R7956:Sorl1 UTSW 9 41,900,655 (GRCm39) missense probably damaging 1.00
R7964:Sorl1 UTSW 9 41,902,697 (GRCm39) missense probably damaging 1.00
R7977:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R7987:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R8151:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R8219:Sorl1 UTSW 9 41,952,857 (GRCm39) splice site probably null
R8261:Sorl1 UTSW 9 41,925,777 (GRCm39) missense probably damaging 1.00
R8283:Sorl1 UTSW 9 41,942,294 (GRCm39) missense probably damaging 1.00
R8308:Sorl1 UTSW 9 41,929,456 (GRCm39) missense probably damaging 1.00
R8348:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8448:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8524:Sorl1 UTSW 9 41,885,370 (GRCm39) missense probably damaging 1.00
R8869:Sorl1 UTSW 9 41,933,722 (GRCm39) missense probably benign 0.01
R8898:Sorl1 UTSW 9 41,911,567 (GRCm39) missense probably damaging 1.00
R8972:Sorl1 UTSW 9 41,957,848 (GRCm39) missense probably damaging 1.00
R9012:Sorl1 UTSW 9 41,982,491 (GRCm39) missense probably damaging 1.00
R9094:Sorl1 UTSW 9 41,975,050 (GRCm39) missense possibly damaging 0.92
R9241:Sorl1 UTSW 9 41,885,420 (GRCm39) nonsense probably null
R9278:Sorl1 UTSW 9 41,957,857 (GRCm39) missense probably benign 0.01
R9288:Sorl1 UTSW 9 41,952,927 (GRCm39) missense probably damaging 1.00
R9303:Sorl1 UTSW 9 41,900,739 (GRCm39) missense probably damaging 1.00
R9330:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 1.00
R9332:Sorl1 UTSW 9 41,912,814 (GRCm39) missense probably damaging 1.00
R9468:Sorl1 UTSW 9 42,035,384 (GRCm39) missense probably benign 0.20
R9528:Sorl1 UTSW 9 41,933,631 (GRCm39) critical splice donor site probably null
R9544:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9563:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9564:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9588:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9634:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R9671:Sorl1 UTSW 9 41,943,077 (GRCm39) missense possibly damaging 0.85
R9701:Sorl1 UTSW 9 42,003,766 (GRCm39) missense probably damaging 1.00
Z1176:Sorl1 UTSW 9 42,035,244 (GRCm39) missense probably benign 0.03
Z1176:Sorl1 UTSW 9 42,010,499 (GRCm39) missense possibly damaging 0.64
Z1177:Sorl1 UTSW 9 42,017,837 (GRCm39) missense probably benign 0.00
Z1177:Sorl1 UTSW 9 41,902,934 (GRCm39) missense possibly damaging 0.92
Z1177:Sorl1 UTSW 9 42,035,208 (GRCm39) missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGACGACACCAGTGTGAG -3'
(R):5'- CTGTTCTGAGAACTGGAAGCTG -3'

Sequencing Primer
(F):5'- GCGGGATTGGCAAATTCTACACC -3'
(R):5'- AAGCTGTCCTTGGGGTGG -3'
Posted On 2016-08-04