Mutagenetix > Incidental Mutation

Incidental Mutation 'R5386:Sorl1'

425236

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

2900010L19Rik, mSorLA, Sorla, LR11

Accession Numbers

Genbank: NM_011436; MGI: 1202296

Essential gene?

Possibly non essential (E-score: 0.346) question?

Stock #

R5386 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41964720-42124297 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 42057284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 558 (T558A)

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060989
AA Change: T558A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: T558A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 134 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,194,413	G887R	probably damaging	Het
4931406P16Rik	A	G	7: 34,242,388	F120L	probably damaging	Het
Abcc12	T	G	8: 86,517,489	K1012Q	possibly damaging	Het
Afmid	G	A	11: 117,828,142	G33R	probably benign	Het
Agbl3	G	T	6: 34,799,196	W207C	probably damaging	Het
Ajuba	T	C	14: 54,570,398	Y459C	probably damaging	Het
Ak2	T	C	4: 129,008,172	S213P	probably benign	Het
Alk	T	A	17: 71,875,012	N1339Y	probably damaging	Het
Angpt1	T	C	15: 42,438,365	S416G	probably damaging	Het
Ank2	C	T	3: 126,981,933	V854M	probably benign	Het
Ankrd61	G	T	5: 143,891,664	N122K	possibly damaging	Het
Armc9	T	A	1: 86,198,289	L34Q	probably null	Het
Aspg	T	A	12: 112,123,032	V418E	probably benign	Het
Baz1b	C	T	5: 135,238,059	R1241C	probably damaging	Het
Bclaf1	T	C	10: 20,325,592	V201A	possibly damaging	Het
C1ql3	A	T	2: 13,004,358	D225E	probably damaging	Het
Capn9	A	G	8: 124,605,540	T417A	possibly damaging	Het
Card14	C	T	11: 119,317,289	R62C	probably damaging	Het
Cc2d2a	A	G	5: 43,730,041	N1271S	probably benign	Het
Ccpg1	G	A	9: 73,013,044	S647N	probably benign	Het
Cdv3	T	C	9: 103,355,230	K133R	possibly damaging	Het
Cep128	A	C	12: 90,999,571	S1087R	probably benign	Het
Cep70	T	A	9: 99,281,075	L325Q	probably damaging	Het
Chit1	T	G	1: 134,149,454	F332V	probably damaging	Het
Chodl	C	A	16: 78,946,697	T219K	probably damaging	Het
Cntn4	T	C	6: 106,181,804	L10P	possibly damaging	Het
Copg1	G	T	6: 87,890,207	M87I	possibly damaging	Het
Cyp3a59	A	G	5: 146,085,768	Y28C	probably benign	Het
Dchs1	A	C	7: 105,758,029	V2119G	probably damaging	Het
Dedd	T	C	1: 171,338,383	L23P	probably damaging	Het
Dmxl2	A	G	9: 54,378,757	S2715P	probably benign	Het
Dnah9	T	C	11: 66,029,356	N2237S	probably damaging	Het
Drosha	A	G	15: 12,842,121	I337V	probably benign	Het
Duox2	A	G	2: 122,295,136	V330A	probably benign	Het
Dusp11	T	C	6: 85,947,605	*322W	probably null	Het
Dusp8	T	A	7: 142,089,993	Q61L	possibly damaging	Het
Ears2	G	C	7: 122,044,377	T426S	probably benign	Het
Elmo1	T	C	13: 20,600,210	Y646H	probably benign	Het
Eps15	T	A	4: 109,321,225	I220K	possibly damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam171a2	C	A	11: 102,437,867	V689L	possibly damaging	Het
Fam213b	T	A	4: 154,899,005	M1L	probably benign	Het
Fam91a1	G	A	15: 58,448,394	S645N	probably benign	Het
Fancg	G	A	4: 43,007,076	Q234*	probably null	Het
Gid4	T	A	11: 60,432,442		probably null	Het
Gm14085	C	A	2: 122,522,778	L480I	probably benign	Het
Gm7361	A	C	5: 26,258,905	T53P	probably benign	Het
Golgb1	T	A	16: 36,912,315	C641*	probably null	Het
Gon4l	T	A	3: 88,858,496	M409K	probably benign	Het
Gpatch8	A	T	11: 102,508,227		probably null	Het
Gpr156	T	A	16: 37,948,309	V64E	possibly damaging	Het
Grid2	T	A	6: 63,931,105	I243K	probably damaging	Het
Gucy2g	G	A	19: 55,215,116	A750V	probably damaging	Het
Hdac5	T	C	11: 102,202,141	E590G	possibly damaging	Het
Herc3	T	A	6: 58,874,278	M504K	probably damaging	Het
Hif1a	A	G	12: 73,944,093	E713G	probably benign	Het
Hmx3	A	G	7: 131,544,304	D247G	probably damaging	Het
Hoxd11	G	T	2: 74,682,819	E143*	probably null	Het
Ifitm3	T	C	7: 141,010,641	N2S	probably benign	Het
Il17f	T	C	1: 20,777,957	Q99R	probably benign	Het
Itga6	T	A	2: 71,841,150	S341R	probably damaging	Het
Itgam	A	G	7: 128,107,980	N661S	probably benign	Het
Jag1	A	T	2: 137,095,544	H303Q	possibly damaging	Het
Kcnh8	T	A	17: 52,725,995	N103K	probably benign	Het
Kdm6b	T	C	11: 69,400,810		probably benign	Het
Keg1	A	C	19: 12,714,538	N63T	probably damaging	Het
Klf12	T	A	14: 99,900,159	H317L	probably damaging	Het
Lrp1	A	T	10: 127,592,114	V530E	probably damaging	Het
Mrgpra6	A	G	7: 47,188,881	C190R	probably damaging	Het
Myo1a	G	T	10: 127,705,897	E102*	probably null	Het
Napa	A	T	7: 16,116,472	E265D	probably benign	Het
Ncam1	A	C	9: 49,564,874	V305G	probably damaging	Het
Nek8	T	C	11: 78,170,437		probably null	Het
Olfr1115	C	T	2: 87,252,483	P182L	probably benign	Het
Olfr1242	G	T	2: 89,494,137	Y58*	probably null	Het
Olfr1275	T	C	2: 111,231,194	T200A	probably benign	Het
Olfr191	T	A	16: 59,085,890	M198L	probably benign	Het
Olfr243	T	C	7: 103,717,355	F254L	probably benign	Het
Olfr251	A	T	9: 38,377,985	I29F	probably benign	Het
Olfr739	T	A	14: 50,425,389	V290E	possibly damaging	Het
Olfr971	A	G	9: 39,839,830	Y132C	possibly damaging	Het
Olfr987	T	C	2: 85,331,635	T88A	probably benign	Het
Pabpc4	A	G	4: 123,294,997	Q417R	probably benign	Het
Panx3	A	T	9: 37,669,024	M11K	probably damaging	Het
Pcbp1	C	T	6: 86,525,489	E143K	probably damaging	Het
Pdcd7	G	A	9: 65,358,692	W477*	probably null	Het
Pi4k2a	G	A	19: 42,090,515	S5N	probably damaging	Het
Plag1	T	A	4: 3,904,075	Q372L	probably benign	Het
Plce1	C	A	19: 38,760,091	N1755K	probably damaging	Het
Pld4	G	T	12: 112,763,988	E102*	probably null	Het
Pnlip	A	G	19: 58,679,607	N345S	probably benign	Het
Ppm1e	A	T	11: 87,358,551	L118Q	possibly damaging	Het
Prkra	T	G	2: 76,639,278	T146P	probably damaging	Het
Prpf8	A	G	11: 75,495,799	D1038G	probably damaging	Het
Prss51	T	A	14: 64,097,094	V108E	probably damaging	Het
Ptch1	A	G	13: 63,545,043	Y181H	probably damaging	Het
Reln	A	G	5: 22,039,529	V817A	probably benign	Het
Rictor	C	A	15: 6,789,504	Q1403K	probably benign	Het
Rims1	T	A	1: 22,412,245	I882F	probably damaging	Het
Rnf19a	A	G	15: 36,242,039	V618A	probably benign	Het
Ryr1	A	T	7: 29,117,416	I65N	probably damaging	Het
S1pr2	T	C	9: 20,967,594	T313A	probably benign	Het
Serpine2	A	T	1: 79,821,287	Y83*	probably null	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Sgip1	T	C	4: 102,915,059	V215A	probably benign	Het
Sgsm3	T	C	15: 81,007,999	V256A	probably benign	Het
Shroom4	T	A	X: 6,585,469	C894*	probably null	Het
Slc14a2	T	A	18: 78,185,840	D306V	possibly damaging	Het
Slc4a10	A	T	2: 62,290,058	E843V	probably damaging	Het
Smyd4	T	A	11: 75,390,156	C152S	probably damaging	Het
Snx10	T	C	6: 51,575,972	Y32H	probably damaging	Het
Spata31d1b	G	A	13: 59,719,052	C1338Y	possibly damaging	Het
Sppl2c	T	A	11: 104,187,301	I309K	possibly damaging	Het
Stard9	A	G	2: 120,700,630	E2456G	probably damaging	Het
Stx1b	A	T	7: 127,815,403	D16E	probably benign	Het
Tecpr2	T	C	12: 110,915,453	V152A	probably damaging	Het
Tedc1	T	C	12: 113,156,682	V47A	probably benign	Het
Tep1	A	T	14: 50,868,317	L82Q	probably damaging	Het
Tgm4	A	G	9: 123,056,494	Y367C	probably damaging	Het
Tle1	C	T	4: 72,141,844	V258M	probably damaging	Het
Tm9sf1	C	T	14: 55,642,844	G32D	possibly damaging	Het
Tmco2	A	G	4: 121,105,984	L106P	probably damaging	Het
Tmem131	A	T	1: 36,872,558	C103S	possibly damaging	Het
Tmprss7	T	A	16: 45,669,528	I444F	possibly damaging	Het
Trank1	T	C	9: 111,362,402	V493A	probably benign	Het
Trim80	A	T	11: 115,448,017	T558S	probably benign	Het
Trmt6	C	A	2: 132,808,783	A302S	probably benign	Het
Ttc17	A	T	2: 94,303,640	W1067R	probably damaging	Het
Tulp4	T	A	17: 6,236,293	V1532D	probably damaging	Het
Ubqlnl	T	G	7: 104,149,217	I358L	probably benign	Het
Ulk3	T	A	9: 57,590,740	I108N	possibly damaging	Het
Vps13b	A	T	15: 35,640,528		probably null	Het
Vwa3a	A	G	7: 120,790,142	K68E	possibly damaging	Het
Zfp746	G	T	6: 48,064,176	H538N	possibly damaging	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41974094	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	42024478	splice site	probably benign
IGL01545:Sorl1	APN	9	42043956	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	42057269	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	42001492	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41980711	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	42004034	missense	probably benign
IGL02215:Sorl1	APN	9	42018182	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	42041690	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	42046561	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	42063774	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	42037059	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	42041053	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	42057325	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41991426	missense	probably benign
IGL03288:Sorl1	APN	9	42033562	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	42041596	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41968622	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	42033577	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	42081954	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	42031909	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	42004088	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41991371	missense	probably null	0.00
R0512:Sorl1	UTSW	9	42067832	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41984506	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	42043900	splice site	probably benign
R0831:Sorl1	UTSW	9	42071069	splice site	probably benign
R0924:Sorl1	UTSW	9	42008174	splice site	probably benign
R1013:Sorl1	UTSW	9	42002559	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41991456	missense	probably benign
R1077:Sorl1	UTSW	9	42014490	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	42031796	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	42000412	splice site	probably null
R1498:Sorl1	UTSW	9	42041073	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41974000	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41996242	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42089965	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41991482	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41969725	nonsense	probably null
R1912:Sorl1	UTSW	9	42081950	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	42046624	missense	probably benign
R2071:Sorl1	UTSW	9	41979457	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41984492	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41980711	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	42037070	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41969781	missense	probably benign
R3815:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	42004105	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41989468	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	42035448	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	42003992	nonsense	probably null
R4610:Sorl1	UTSW	9	42031914	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41984508	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41992321	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	42063752	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	42041639	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	42014450	splice site	probably null
R4976:Sorl1	UTSW	9	41983003	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41991342	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41996294	missense	probably benign
R5070:Sorl1	UTSW	9	42031818	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41976377	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	42033583	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42106516	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	42030902	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41979390	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	42002636	nonsense	probably null
R5518:Sorl1	UTSW	9	42037212	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41991625	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42092373	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41983034	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41969742	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41976407	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	42071234	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	42001603	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41980645	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42092452	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42099263	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	42024398	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	42022392	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	42033626	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41969751	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	42030983	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	42002634	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42124079	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	42037203	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	42063710	splice site	probably null
R7537:Sorl1	UTSW	9	41980688	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41977582	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42092334	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41984526	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	42043909	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42089961	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41989359	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41991401	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	42041561	splice site	probably null
R8261:Sorl1	UTSW	9	42014481	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	42030998	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	42018160	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41974074	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	42022426	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	42000271	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	42046552	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	42071195	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	42063754	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41974124	nonsense	probably null
R9278:Sorl1	UTSW	9	42046561	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	42041631	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41989443	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	42067933	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	42001518	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42124088	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	42022335	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	42081809	nonsense	probably null
R9563:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	42081809	nonsense	probably null
R9634:Sorl1	UTSW	9	41996294	missense	probably benign
R9671:Sorl1	UTSW	9	42031781	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42092470	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42099203	missense	possibly damaging	0.64
Z1176:Sorl1	UTSW	9	42123948	missense	probably benign	0.03
Z1177:Sorl1	UTSW	9	41991638	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42106541	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	42123912	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	42041596	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGACGACACCAGTGTGAG -3'
(R):5'- CTGTTCTGAGAACTGGAAGCTG -3'

Sequencing Primer
(F):5'- GCGGGATTGGCAAATTCTACACC -3'
(R):5'- AAGCTGTCCTTGGGGTGG -3'

Posted On

2016-08-04