Mutagenetix > Incidental Mutation

Incidental Mutation 'R5386:Lrp1'

425247

Institutional Source

Beutler Lab

Gene Symbol

Lrp1

Ensembl Gene

ENSMUSG00000040249

Gene Name

low density lipoprotein receptor-related protein 1

Synonyms

A2mr, b2b1554Clo, CD91

Accession Numbers

NCBI RefSeq: NM_008512.2; MGI:96828

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5386 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

127538161-127621148 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 127592114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 530 (V530E)

Ref Sequence

ENSEMBL: ENSMUSP00000044004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049149] [ENSMUST00000121829]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000049149
AA Change: V530E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000044004
Gene: ENSMUSG00000040249
AA Change: V530E

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
LDLa	27	67	1.03e-15	SMART
LDLa	72	111	1.04e-11	SMART
EGF	115	150	8.78e-2	SMART
EGF_CA	151	190	4.49e-8	SMART
low complexity region	222	232	N/A	INTRINSIC
LY	273	315	7.07e-6	SMART
LY	316	359	2.31e-10	SMART
LY	360	402	8.3e-12	SMART
EGF	478	521	9.93e-1	SMART
LY	552	594	8.84e-7	SMART
LY	595	638	6.54e-10	SMART
LY	641	690	2.5e-15	SMART
LY	691	734	1.06e-9	SMART
EGF	807	844	1.38e1	SMART
LDLa	854	893	3.39e-16	SMART
LDLa	895	934	1.73e-13	SMART
LDLa	936	974	4.47e-16	SMART
LDLa	976	1014	2.53e-15	SMART
LDLa	1015	1054	2.95e-16	SMART
LDLa	1062	1100	3.24e-13	SMART
LDLa	1104	1143	2.97e-12	SMART
LDLa	1145	1185	1.24e-9	SMART
EGF	1185	1223	4.97e-1	SMART
EGF	1227	1263	6.02e0	SMART
LY	1290	1332	3.76e-1	SMART
LY	1337	1379	8.56e-14	SMART
LY	1380	1424	8.43e-13	SMART
LY	1425	1469	3.05e-10	SMART
LY	1471	1513	3.88e-3	SMART
EGF	1540	1580	1.85e0	SMART
LY	1606	1650	2.83e-5	SMART
LY	1651	1695	2.01e-10	SMART
LY	1698	1735	1.87e-5	SMART
LY	1736	1777	3.54e-6	SMART
LY	1778	1820	4.17e1	SMART
EGF	1850	1888	1.24e-1	SMART
LY	1915	1957	3.2e-4	SMART
LY	1958	2000	2.33e-15	SMART
LY	2001	2044	7.45e-14	SMART
LY	2045	2087	3.87e-12	SMART
LY	2089	2131	1.37e0	SMART
EGF	2159	2196	1.66e1	SMART
LY	2276	2318	5.57e-4	SMART
LY	2324	2369	3.3e-6	SMART
LY	2370	2412	3.93e-13	SMART
LY	2413	2454	3.62e-3	SMART
EGF_like	2482	2519	3.16e1	SMART
LDLa	2524	2564	3.31e-10	SMART
LDLa	2566	2603	7.21e-11	SMART
LDLa	2605	2642	1.09e-10	SMART
LDLa	2660	2691	6.05e-4	SMART
LDLa	2696	2733	2.49e-14	SMART
LDLa	2734	2772	4.65e-14	SMART
LDLa	2774	2815	3.92e-12	SMART
LDLa	2818	2856	1.51e-13	SMART
LDLa	2858	2900	1.93e-11	SMART
LDLa	2904	2942	1.73e-13	SMART
EGF_CA	2941	2982	6.16e-6	SMART
EGF_CA	2983	3023	2.66e-10	SMART
LY	3050	3094	6.64e-11	SMART
LY	3095	3137	7.17e-16	SMART
LY	3138	3181	4.28e-14	SMART
LY	3182	3224	8.11e-15	SMART
LY	3225	3265	1.44e-6	SMART
EGF	3294	3332	1.02e-2	SMART
LDLa	3334	3372	2.25e-12	SMART
LDLa	3374	3411	9.81e-13	SMART
LDLa	3413	3451	9.81e-13	SMART
LDLa	3453	3492	5.67e-18	SMART
LDLa	3494	3534	7.15e-15	SMART
LDLa	3536	3573	1.79e-15	SMART
EGF_like	3575	3611	4.83e1	SMART
LDLa	3575	3612	1.92e-15	SMART
LDLa	3613	3650	1.18e-15	SMART
LDLa	3654	3693	7.55e-14	SMART
LDLa	3695	3734	1.14e-8	SMART
LDLa	3741	3779	6.28e-11	SMART
EGF	3785	3824	1.06e1	SMART
EGF	3828	3862	1.51e0	SMART
LY	3893	3935	9.43e0	SMART
LY	3951	3993	1.23e-14	SMART
LY	3994	4037	2.98e-13	SMART
LY	4038	4080	4.28e-14	SMART
EGF	4151	4184	3.76e-1	SMART
low complexity region	4185	4198	N/A	INTRINSIC
EGF	4200	4233	3.82e-2	SMART
EGF	4236	4269	4.03e-1	SMART
EGF	4272	4305	5.2e-4	SMART
EGF	4308	4341	1.22e0	SMART
EGF_like	4344	4376	4.11e1	SMART
EGF	4377	4410	5.12e-3	SMART
transmembrane domain	4423	4445	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121829
AA Change: V530E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113584
Gene: ENSMUSG00000040249
AA Change: V530E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LDLa	27	67	1.03e-15	SMART
LDLa	72	111	1.04e-11	SMART
EGF	115	150	8.78e-2	SMART
EGF_CA	151	190	4.49e-8	SMART
low complexity region	222	232	N/A	INTRINSIC
LY	273	315	7.07e-6	SMART
LY	316	359	2.31e-10	SMART
LY	360	402	8.3e-12	SMART
EGF	478	521	9.93e-1	SMART
LY	552	594	8.84e-7	SMART
LY	595	638	6.54e-10	SMART
LY	641	690	2.5e-15	SMART
LY	691	734	1.06e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124182

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125480

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

Strain: 2178192
Lethality: E10-E13
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor family of proteins. The encoded preproprotein is proteolytically processed by furin to generate 515 kDa and 85 kDa subunits that form the mature receptor (PMID: 8546712). This receptor is involved in several cellular processes, including intracellular signaling, lipid homeostasis, and clearance of apoptotic cells. In addition, the encoded protein is necessary for the alpha 2-macroglobulin-mediated clearance of secreted amyloid precursor protein and beta-amyloid, the main component of amyloid plaques found in Alzheimer patients. Expression of this gene decreases with age and has been found to be lower than controls in brain tissue from Alzheimer's disease patients. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality during late organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(42) : Targeted(9) Gene trapped(33)

Other mutations in this stock

Total: 134 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,194,413	G887R	probably damaging	Het
4931406P16Rik	A	G	7: 34,242,388	F120L	probably damaging	Het
Abcc12	T	G	8: 86,517,489	K1012Q	possibly damaging	Het
Afmid	G	A	11: 117,828,142	G33R	probably benign	Het
Agbl3	G	T	6: 34,799,196	W207C	probably damaging	Het
Ajuba	T	C	14: 54,570,398	Y459C	probably damaging	Het
Ak2	T	C	4: 129,008,172	S213P	probably benign	Het
Alk	T	A	17: 71,875,012	N1339Y	probably damaging	Het
Angpt1	T	C	15: 42,438,365	S416G	probably damaging	Het
Ank2	C	T	3: 126,981,933	V854M	probably benign	Het
Ankrd61	G	T	5: 143,891,664	N122K	possibly damaging	Het
Armc9	T	A	1: 86,198,289	L34Q	probably null	Het
Aspg	T	A	12: 112,123,032	V418E	probably benign	Het
Baz1b	C	T	5: 135,238,059	R1241C	probably damaging	Het
Bclaf1	T	C	10: 20,325,592	V201A	possibly damaging	Het
C1ql3	A	T	2: 13,004,358	D225E	probably damaging	Het
Capn9	A	G	8: 124,605,540	T417A	possibly damaging	Het
Card14	C	T	11: 119,317,289	R62C	probably damaging	Het
Cc2d2a	A	G	5: 43,730,041	N1271S	probably benign	Het
Ccpg1	G	A	9: 73,013,044	S647N	probably benign	Het
Cdv3	T	C	9: 103,355,230	K133R	possibly damaging	Het
Cep128	A	C	12: 90,999,571	S1087R	probably benign	Het
Cep70	T	A	9: 99,281,075	L325Q	probably damaging	Het
Chit1	T	G	1: 134,149,454	F332V	probably damaging	Het
Chodl	C	A	16: 78,946,697	T219K	probably damaging	Het
Cntn4	T	C	6: 106,181,804	L10P	possibly damaging	Het
Copg1	G	T	6: 87,890,207	M87I	possibly damaging	Het
Cyp3a59	A	G	5: 146,085,768	Y28C	probably benign	Het
Dchs1	A	C	7: 105,758,029	V2119G	probably damaging	Het
Dedd	T	C	1: 171,338,383	L23P	probably damaging	Het
Dmxl2	A	G	9: 54,378,757	S2715P	probably benign	Het
Dnah9	T	C	11: 66,029,356	N2237S	probably damaging	Het
Drosha	A	G	15: 12,842,121	I337V	probably benign	Het
Duox2	A	G	2: 122,295,136	V330A	probably benign	Het
Dusp11	T	C	6: 85,947,605	*322W	probably null	Het
Dusp8	T	A	7: 142,089,993	Q61L	possibly damaging	Het
Ears2	G	C	7: 122,044,377	T426S	probably benign	Het
Elmo1	T	C	13: 20,600,210	Y646H	probably benign	Het
Eps15	T	A	4: 109,321,225	I220K	possibly damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam171a2	C	A	11: 102,437,867	V689L	possibly damaging	Het
Fam213b	T	A	4: 154,899,005	M1L	probably benign	Het
Fam91a1	G	A	15: 58,448,394	S645N	probably benign	Het
Fancg	G	A	4: 43,007,076	Q234*	probably null	Het
Gid4	T	A	11: 60,432,442		probably null	Het
Gm14085	C	A	2: 122,522,778	L480I	probably benign	Het
Gm7361	A	C	5: 26,258,905	T53P	probably benign	Het
Golgb1	T	A	16: 36,912,315	C641*	probably null	Het
Gon4l	T	A	3: 88,858,496	M409K	probably benign	Het
Gpatch8	A	T	11: 102,508,227		probably null	Het
Gpr156	T	A	16: 37,948,309	V64E	possibly damaging	Het
Grid2	T	A	6: 63,931,105	I243K	probably damaging	Het
Gucy2g	G	A	19: 55,215,116	A750V	probably damaging	Het
Hdac5	T	C	11: 102,202,141	E590G	possibly damaging	Het
Herc3	T	A	6: 58,874,278	M504K	probably damaging	Het
Hif1a	A	G	12: 73,944,093	E713G	probably benign	Het
Hmx3	A	G	7: 131,544,304	D247G	probably damaging	Het
Hoxd11	G	T	2: 74,682,819	E143*	probably null	Het
Ifitm3	T	C	7: 141,010,641	N2S	probably benign	Het
Il17f	T	C	1: 20,777,957	Q99R	probably benign	Het
Itga6	T	A	2: 71,841,150	S341R	probably damaging	Het
Itgam	A	G	7: 128,107,980	N661S	probably benign	Het
Jag1	A	T	2: 137,095,544	H303Q	possibly damaging	Het
Kcnh8	T	A	17: 52,725,995	N103K	probably benign	Het
Kdm6b	T	C	11: 69,400,810		probably benign	Het
Keg1	A	C	19: 12,714,538	N63T	probably damaging	Het
Klf12	T	A	14: 99,900,159	H317L	probably damaging	Het
Mrgpra6	A	G	7: 47,188,881	C190R	probably damaging	Het
Myo1a	G	T	10: 127,705,897	E102*	probably null	Het
Napa	A	T	7: 16,116,472	E265D	probably benign	Het
Ncam1	A	C	9: 49,564,874	V305G	probably damaging	Het
Nek8	T	C	11: 78,170,437		probably null	Het
Olfr1115	C	T	2: 87,252,483	P182L	probably benign	Het
Olfr1242	G	T	2: 89,494,137	Y58*	probably null	Het
Olfr1275	T	C	2: 111,231,194	T200A	probably benign	Het
Olfr191	T	A	16: 59,085,890	M198L	probably benign	Het
Olfr243	T	C	7: 103,717,355	F254L	probably benign	Het
Olfr251	A	T	9: 38,377,985	I29F	probably benign	Het
Olfr739	T	A	14: 50,425,389	V290E	possibly damaging	Het
Olfr971	A	G	9: 39,839,830	Y132C	possibly damaging	Het
Olfr987	T	C	2: 85,331,635	T88A	probably benign	Het
Pabpc4	A	G	4: 123,294,997	Q417R	probably benign	Het
Panx3	A	T	9: 37,669,024	M11K	probably damaging	Het
Pcbp1	C	T	6: 86,525,489	E143K	probably damaging	Het
Pdcd7	G	A	9: 65,358,692	W477*	probably null	Het
Pi4k2a	G	A	19: 42,090,515	S5N	probably damaging	Het
Plag1	T	A	4: 3,904,075	Q372L	probably benign	Het
Plce1	C	A	19: 38,760,091	N1755K	probably damaging	Het
Pld4	G	T	12: 112,763,988	E102*	probably null	Het
Pnlip	A	G	19: 58,679,607	N345S	probably benign	Het
Ppm1e	A	T	11: 87,358,551	L118Q	possibly damaging	Het
Prkra	T	G	2: 76,639,278	T146P	probably damaging	Het
Prpf8	A	G	11: 75,495,799	D1038G	probably damaging	Het
Prss51	T	A	14: 64,097,094	V108E	probably damaging	Het
Ptch1	A	G	13: 63,545,043	Y181H	probably damaging	Het
Reln	A	G	5: 22,039,529	V817A	probably benign	Het
Rictor	C	A	15: 6,789,504	Q1403K	probably benign	Het
Rims1	T	A	1: 22,412,245	I882F	probably damaging	Het
Rnf19a	A	G	15: 36,242,039	V618A	probably benign	Het
Ryr1	A	T	7: 29,117,416	I65N	probably damaging	Het
S1pr2	T	C	9: 20,967,594	T313A	probably benign	Het
Serpine2	A	T	1: 79,821,287	Y83*	probably null	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Sgip1	T	C	4: 102,915,059	V215A	probably benign	Het
Sgsm3	T	C	15: 81,007,999	V256A	probably benign	Het
Shroom4	T	A	X: 6,585,469	C894*	probably null	Het
Slc14a2	T	A	18: 78,185,840	D306V	possibly damaging	Het
Slc4a10	A	T	2: 62,290,058	E843V	probably damaging	Het
Smyd4	T	A	11: 75,390,156	C152S	probably damaging	Het
Snx10	T	C	6: 51,575,972	Y32H	probably damaging	Het
Sorl1	T	C	9: 42,057,284	T558A	possibly damaging	Het
Spata31d1b	G	A	13: 59,719,052	C1338Y	possibly damaging	Het
Sppl2c	T	A	11: 104,187,301	I309K	possibly damaging	Het
Stard9	A	G	2: 120,700,630	E2456G	probably damaging	Het
Stx1b	A	T	7: 127,815,403	D16E	probably benign	Het
Tecpr2	T	C	12: 110,915,453	V152A	probably damaging	Het
Tedc1	T	C	12: 113,156,682	V47A	probably benign	Het
Tep1	A	T	14: 50,868,317	L82Q	probably damaging	Het
Tgm4	A	G	9: 123,056,494	Y367C	probably damaging	Het
Tle1	C	T	4: 72,141,844	V258M	probably damaging	Het
Tm9sf1	C	T	14: 55,642,844	G32D	possibly damaging	Het
Tmco2	A	G	4: 121,105,984	L106P	probably damaging	Het
Tmem131	A	T	1: 36,872,558	C103S	possibly damaging	Het
Tmprss7	T	A	16: 45,669,528	I444F	possibly damaging	Het
Trank1	T	C	9: 111,362,402	V493A	probably benign	Het
Trim80	A	T	11: 115,448,017	T558S	probably benign	Het
Trmt6	C	A	2: 132,808,783	A302S	probably benign	Het
Ttc17	A	T	2: 94,303,640	W1067R	probably damaging	Het
Tulp4	T	A	17: 6,236,293	V1532D	probably damaging	Het
Ubqlnl	T	G	7: 104,149,217	I358L	probably benign	Het
Ulk3	T	A	9: 57,590,740	I108N	possibly damaging	Het
Vps13b	A	T	15: 35,640,528		probably null	Het
Vwa3a	A	G	7: 120,790,142	K68E	possibly damaging	Het
Zfp746	G	T	6: 48,064,176	H538N	possibly damaging	Het

Other mutations in Lrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Lrp1	APN	10	127542205	missense	possibly damaging	0.89
IGL01065:Lrp1	APN	10	127575038	missense	probably benign	0.10
IGL01121:Lrp1	APN	10	127583853	nonsense	probably null
IGL01360:Lrp1	APN	10	127545820	missense	possibly damaging	0.93
IGL01402:Lrp1	APN	10	127595032	missense	probably damaging	1.00
IGL01404:Lrp1	APN	10	127595032	missense	probably damaging	1.00
IGL01411:Lrp1	APN	10	127581765	nonsense	probably null
IGL01469:Lrp1	APN	10	127584414	missense	probably damaging	1.00
IGL01552:Lrp1	APN	10	127588510	nonsense	probably null
IGL01682:Lrp1	APN	10	127574978	missense	probably benign	0.00
IGL01760:Lrp1	APN	10	127573501	missense	probably benign	0.00
IGL01918:Lrp1	APN	10	127554589	missense	probably damaging	0.99
IGL01989:Lrp1	APN	10	127578129	missense	probably damaging	1.00
IGL02105:Lrp1	APN	10	127544579	missense	probably damaging	1.00
IGL02158:Lrp1	APN	10	127554271	missense	probably benign	0.02
IGL02164:Lrp1	APN	10	127563667	missense	probably benign	0.39
IGL02337:Lrp1	APN	10	127576887	missense	possibly damaging	0.87
IGL02425:Lrp1	APN	10	127571887	critical splice donor site	probably null
IGL02493:Lrp1	APN	10	127581778	missense	probably damaging	0.99
IGL02563:Lrp1	APN	10	127551686	missense	probably damaging	1.00
IGL02590:Lrp1	APN	10	127552791	missense	probably damaging	1.00
IGL02624:Lrp1	APN	10	127572422	missense	probably damaging	0.98
IGL02625:Lrp1	APN	10	127574486	missense	probably damaging	1.00
IGL02825:Lrp1	APN	10	127542605	missense	probably damaging	1.00
IGL02880:Lrp1	APN	10	127540222	missense	probably benign	0.12
IGL02900:Lrp1	APN	10	127576647	splice site	probably benign
IGL02956:Lrp1	APN	10	127544559	missense	probably benign	0.00
IGL02974:Lrp1	APN	10	127555016	missense	probably damaging	0.99
IGL02983:Lrp1	APN	10	127550199	missense	probably damaging	1.00
IGL03002:Lrp1	APN	10	127589636	missense	probably damaging	1.00
IGL03091:Lrp1	APN	10	127559124	missense	probably benign	0.30
IGL03109:Lrp1	APN	10	127566645	missense	probably benign
IGL03194:Lrp1	APN	10	127568685	missense	probably damaging	1.00
IGL03232:Lrp1	APN	10	127539376	missense	probably damaging	1.00
calculus	UTSW	10	127558068	splice site	probably null
Delimiter	UTSW	10	127546862	missense	probably damaging	1.00
extremis	UTSW	10	127556988	missense	probably benign	0.00
Jockey	UTSW	10	127560136	missense	probably damaging	1.00
peripheral	UTSW	10	127610381	missense	probably damaging	1.00
tangential	UTSW	10	127593848	missense	probably damaging	0.99
P0015:Lrp1	UTSW	10	127566663	missense	probably damaging	0.99
PIT4519001:Lrp1	UTSW	10	127607974	missense	possibly damaging	0.91
PIT4520001:Lrp1	UTSW	10	127607974	missense	possibly damaging	0.91
R0004:Lrp1	UTSW	10	127541825	splice site	probably null
R0034:Lrp1	UTSW	10	127545651	missense	probably benign	0.42
R0091:Lrp1	UTSW	10	127540979	missense	probably damaging	1.00
R0098:Lrp1	UTSW	10	127552738	missense	probably benign
R0098:Lrp1	UTSW	10	127552738	missense	probably benign
R0143:Lrp1	UTSW	10	127593942	missense	probably damaging	1.00
R0372:Lrp1	UTSW	10	127592136	missense	probably damaging	1.00
R0379:Lrp1	UTSW	10	127594969	missense	probably damaging	1.00
R0445:Lrp1	UTSW	10	127590636	nonsense	probably null
R0529:Lrp1	UTSW	10	127541594	splice site	probably null
R0551:Lrp1	UTSW	10	127571958	missense	probably benign
R0570:Lrp1	UTSW	10	127555009	nonsense	probably null
R0600:Lrp1	UTSW	10	127567383	missense	probably benign	0.00
R0626:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R0647:Lrp1	UTSW	10	127571477	missense	probably damaging	1.00
R0680:Lrp1	UTSW	10	127589661	missense	probably damaging	1.00
R0792:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R0792:Lrp1	UTSW	10	127575286	missense	probably benign	0.04
R0848:Lrp1	UTSW	10	127553362	splice site	probably null
R0866:Lrp1	UTSW	10	127539278	missense	probably damaging	1.00
R0918:Lrp1	UTSW	10	127593965	missense	probably damaging	1.00
R1076:Lrp1	UTSW	10	127563797	splice site	probably benign
R1107:Lrp1	UTSW	10	127557435	missense	probably damaging	1.00
R1346:Lrp1	UTSW	10	127605866	missense	probably damaging	1.00
R1403:Lrp1	UTSW	10	127581891	critical splice acceptor site	probably null
R1403:Lrp1	UTSW	10	127581891	critical splice acceptor site	probably null
R1496:Lrp1	UTSW	10	127539011	missense	probably damaging	1.00
R1522:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R1522:Lrp1	UTSW	10	127575286	missense	probably benign	0.04
R1525:Lrp1	UTSW	10	127539529	missense	probably damaging	1.00
R1539:Lrp1	UTSW	10	127584381	splice site	probably null
R1589:Lrp1	UTSW	10	127605606	missense	probably benign	0.00
R1591:Lrp1	UTSW	10	127605606	missense	probably benign	0.00
R1663:Lrp1	UTSW	10	127556921	missense	probably damaging	1.00
R1682:Lrp1	UTSW	10	127574332	missense	probably damaging	1.00
R1717:Lrp1	UTSW	10	127556269	missense	possibly damaging	0.59
R1717:Lrp1	UTSW	10	127563665	missense	probably damaging	1.00
R1758:Lrp1	UTSW	10	127588584	missense	possibly damaging	0.76
R1826:Lrp1	UTSW	10	127553707	missense	probably damaging	1.00
R1842:Lrp1	UTSW	10	127573468	missense	possibly damaging	0.93
R1844:Lrp1	UTSW	10	127595283	critical splice donor site	probably null
R1845:Lrp1	UTSW	10	127578673	missense	probably damaging	1.00
R1896:Lrp1	UTSW	10	127559998	missense	possibly damaging	0.64
R1952:Lrp1	UTSW	10	127567431	missense	probably damaging	1.00
R2009:Lrp1	UTSW	10	127544516	missense	probably damaging	1.00
R2015:Lrp1	UTSW	10	127540694	missense	probably benign	0.00
R2116:Lrp1	UTSW	10	127576493	nonsense	probably null
R2161:Lrp1	UTSW	10	127555738	missense	probably damaging	1.00
R2199:Lrp1	UTSW	10	127546840	missense	probably damaging	1.00
R2213:Lrp1	UTSW	10	127540702	missense	probably damaging	1.00
R2300:Lrp1	UTSW	10	127556915	nonsense	probably null
R2324:Lrp1	UTSW	10	127566586	missense	possibly damaging	0.92
R2849:Lrp1	UTSW	10	127542296	missense	probably damaging	1.00
R2926:Lrp1	UTSW	10	127588113	missense	probably damaging	0.98
R2993:Lrp1	UTSW	10	127610381	missense	probably damaging	1.00
R3522:Lrp1	UTSW	10	127553555	missense	probably damaging	1.00
R3702:Lrp1	UTSW	10	127595103	missense	probably damaging	1.00
R3789:Lrp1	UTSW	10	127571969	missense	possibly damaging	0.94
R3898:Lrp1	UTSW	10	127592100	nonsense	probably null
R3941:Lrp1	UTSW	10	127553396	missense	probably damaging	1.00
R3958:Lrp1	UTSW	10	127571958	missense	probably benign
R4369:Lrp1	UTSW	10	127550286	missense	possibly damaging	0.87
R4510:Lrp1	UTSW	10	127593848	missense	probably damaging	0.99
R4511:Lrp1	UTSW	10	127593848	missense	probably damaging	0.99
R4576:Lrp1	UTSW	10	127540188	small deletion	probably benign
R4583:Lrp1	UTSW	10	127541372	missense	probably benign	0.00
R4662:Lrp1	UTSW	10	127552185	nonsense	probably null
R4721:Lrp1	UTSW	10	127555059	missense	possibly damaging	0.58
R4728:Lrp1	UTSW	10	127563737	missense	probably damaging	1.00
R4745:Lrp1	UTSW	10	127549944	missense	probably benign	0.20
R4785:Lrp1	UTSW	10	127558133	missense	probably benign	0.12
R4841:Lrp1	UTSW	10	127583936	missense	probably damaging	1.00
R4842:Lrp1	UTSW	10	127583936	missense	probably damaging	1.00
R4855:Lrp1	UTSW	10	127610442	missense	probably benign	0.03
R4860:Lrp1	UTSW	10	127553824	missense	probably damaging	1.00
R4860:Lrp1	UTSW	10	127553824	missense	probably damaging	1.00
R4891:Lrp1	UTSW	10	127541752	missense	probably damaging	1.00
R4925:Lrp1	UTSW	10	127575075	nonsense	probably null
R4970:Lrp1	UTSW	10	127539520	missense	probably benign	0.11
R4999:Lrp1	UTSW	10	127553779	missense	probably damaging	1.00
R5044:Lrp1	UTSW	10	127567495	missense	probably damaging	1.00
R5127:Lrp1	UTSW	10	127539634	intron	probably benign
R5188:Lrp1	UTSW	10	127607952	missense	probably damaging	1.00
R5218:Lrp1	UTSW	10	127548619	missense	probably damaging	1.00
R5225:Lrp1	UTSW	10	127556096	missense	probably benign	0.04
R5291:Lrp1	UTSW	10	127593878	missense	probably damaging	1.00
R5395:Lrp1	UTSW	10	127595297	missense	probably damaging	1.00
R5413:Lrp1	UTSW	10	127588067	critical splice donor site	probably null
R5430:Lrp1	UTSW	10	127541061	missense	probably damaging	0.99
R5499:Lrp1	UTSW	10	127572944	missense	possibly damaging	0.58
R5526:Lrp1	UTSW	10	127555724	missense	probably benign	0.37
R5580:Lrp1	UTSW	10	127588520	missense	probably benign
R5583:Lrp1	UTSW	10	127588463	missense	probably benign	0.08
R5599:Lrp1	UTSW	10	127593869	missense	probably damaging	1.00
R5639:Lrp1	UTSW	10	127593839	missense	probably damaging	0.99
R5677:Lrp1	UTSW	10	127574429	missense	probably damaging	1.00
R5730:Lrp1	UTSW	10	127583834	missense	probably benign	0.00
R5742:Lrp1	UTSW	10	127548347	missense	probably damaging	0.98
R5764:Lrp1	UTSW	10	127595318	missense	probably benign	0.41
R5864:Lrp1	UTSW	10	127567505	missense	possibly damaging	0.58
R5937:Lrp1	UTSW	10	127583876	missense	possibly damaging	0.93
R5947:Lrp1	UTSW	10	127589554	critical splice donor site	probably null
R5976:Lrp1	UTSW	10	127583901	missense	probably damaging	1.00
R6021:Lrp1	UTSW	10	127578014	missense	probably damaging	1.00
R6026:Lrp1	UTSW	10	127573403	missense	probably damaging	1.00
R6045:Lrp1	UTSW	10	127566600	missense	probably damaging	0.98
R6057:Lrp1	UTSW	10	127567490	missense	probably damaging	1.00
R6084:Lrp1	UTSW	10	127560553	missense	probably benign	0.09
R6131:Lrp1	UTSW	10	127560157	missense	probably benign
R6235:Lrp1	UTSW	10	127588177	missense	probably damaging	1.00
R6280:Lrp1	UTSW	10	127589584	missense	probably benign	0.04
R6307:Lrp1	UTSW	10	127592075	missense	probably damaging	1.00
R6532:Lrp1	UTSW	10	127541682	missense	probably damaging	1.00
R6532:Lrp1	UTSW	10	127549407	missense	probably damaging	1.00
R6536:Lrp1	UTSW	10	127558068	splice site	probably null
R6605:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6607:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6631:Lrp1	UTSW	10	127574332	missense	probably damaging	1.00
R6676:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6678:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6809:Lrp1	UTSW	10	127555056	missense	probably benign	0.04
R6884:Lrp1	UTSW	10	127559117	missense	probably benign	0.00
R6925:Lrp1	UTSW	10	127556988	missense	probably benign	0.00
R6987:Lrp1	UTSW	10	127575005	missense	probably damaging	1.00
R7016:Lrp1	UTSW	10	127559967	critical splice donor site	probably null
R7030:Lrp1	UTSW	10	127552876	missense	probably damaging	0.97
R7053:Lrp1	UTSW	10	127541094	missense	probably damaging	1.00
R7076:Lrp1	UTSW	10	127550183	critical splice donor site	probably null
R7136:Lrp1	UTSW	10	127558622	missense	probably damaging	1.00
R7180:Lrp1	UTSW	10	127556965	missense	probably damaging	1.00
R7199:Lrp1	UTSW	10	127573456	missense	probably damaging	0.99
R7219:Lrp1	UTSW	10	127557228	missense	probably benign	0.40
R7233:Lrp1	UTSW	10	127595061	missense	probably damaging	1.00
R7251:Lrp1	UTSW	10	127572554	missense	probably damaging	1.00
R7264:Lrp1	UTSW	10	127592093	missense	probably damaging	1.00
R7302:Lrp1	UTSW	10	127538987	missense	probably benign	0.01
R7313:Lrp1	UTSW	10	127553468	missense	probably damaging	1.00
R7322:Lrp1	UTSW	10	127545564	missense	probably benign	0.24
R7354:Lrp1	UTSW	10	127571408	missense	probably damaging	1.00
R7375:Lrp1	UTSW	10	127539348	missense	probably damaging	1.00
R7388:Lrp1	UTSW	10	127583897	nonsense	probably null
R7404:Lrp1	UTSW	10	127582708	missense
R7405:Lrp1	UTSW	10	127581751	missense	possibly damaging	0.93
R7477:Lrp1	UTSW	10	127568920	missense	probably damaging	1.00
R7555:Lrp1	UTSW	10	127546862	missense	probably damaging	1.00
R7600:Lrp1	UTSW	10	127555706	missense	probably benign
R7678:Lrp1	UTSW	10	127574053	missense	probably damaging	1.00
R7679:Lrp1	UTSW	10	127588428	nonsense	probably null
R7951:Lrp1	UTSW	10	127539064	nonsense	probably null
R7964:Lrp1	UTSW	10	127575044	missense	possibly damaging	0.94
R8006:Lrp1	UTSW	10	127589619	missense	probably damaging	1.00
R8021:Lrp1	UTSW	10	127548346	missense	possibly damaging	0.92
R8098:Lrp1	UTSW	10	127574455	missense	possibly damaging	0.78
R8112:Lrp1	UTSW	10	127605846	missense	probably damaging	1.00
R8210:Lrp1	UTSW	10	127576485	missense	probably damaging	1.00
R8249:Lrp1	UTSW	10	127605543	missense	probably benign
R8291:Lrp1	UTSW	10	127589703	missense	probably damaging	1.00
R8332:Lrp1	UTSW	10	127571936	missense	probably damaging	1.00
R8435:Lrp1	UTSW	10	127556330	missense	probably damaging	0.97
R8467:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8468:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8474:Lrp1	UTSW	10	127539703	missense	probably damaging	1.00
R8481:Lrp1	UTSW	10	127568910	missense	probably damaging	1.00
R8483:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8485:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8488:Lrp1	UTSW	10	127560487	missense	probably damaging	1.00
R8715:Lrp1	UTSW	10	127560621	missense	possibly damaging	0.77
R8790:Lrp1	UTSW	10	127539077	missense	probably damaging	1.00
R8854:Lrp1	UTSW	10	127543099	missense	probably damaging	1.00
R8926:Lrp1	UTSW	10	127545802	missense	probably benign
R8949:Lrp1	UTSW	10	127589536	intron	probably benign
R8971:Lrp1	UTSW	10	127556027	missense	possibly damaging	0.94
R9103:Lrp1	UTSW	10	127595110	nonsense	probably null
R9108:Lrp1	UTSW	10	127554337	missense	probably damaging	0.99
R9130:Lrp1	UTSW	10	127546412	missense	probably benign	0.18
R9157:Lrp1	UTSW	10	127574340	missense	probably damaging	1.00
R9162:Lrp1	UTSW	10	127605499	missense	probably benign	0.32
R9205:Lrp1	UTSW	10	127594981	nonsense	probably null
R9228:Lrp1	UTSW	10	127546938	missense	probably damaging	0.98
R9231:Lrp1	UTSW	10	127546399	missense	probably benign	0.06
R9287:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R9381:Lrp1	UTSW	10	127605468	missense	probably benign	0.17
R9412:Lrp1	UTSW	10	127573418	missense	probably damaging	1.00
R9434:Lrp1	UTSW	10	127545820	missense	possibly damaging	0.93
R9463:Lrp1	UTSW	10	127593465	nonsense	probably null
R9526:Lrp1	UTSW	10	127595360	missense	probably damaging	0.96
R9548:Lrp1	UTSW	10	127552864	missense	probably damaging	0.99
R9599:Lrp1	UTSW	10	127574377	missense	probably damaging	1.00
R9649:Lrp1	UTSW	10	127573499	missense	probably benign	0.14
R9687:Lrp1	UTSW	10	127566693	missense	probably damaging	1.00
R9707:Lrp1	UTSW	10	127572545	missense	probably benign	0.08
R9770:Lrp1	UTSW	10	127584399	missense	probably damaging	1.00
V3553:Lrp1	UTSW	10	127571442	missense	probably damaging	1.00
Y5406:Lrp1	UTSW	10	127554283	missense	probably damaging	1.00
Z1088:Lrp1	UTSW	10	127584379	missense	probably damaging	1.00
Z1176:Lrp1	UTSW	10	127554962	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTTCTGGCGGCCAATGAGG -3'
(R):5'- GCACCTCAGACCCAGATTTC -3'

Sequencing Primer
(F):5'- CGGCCAATGAGGTAGCTG -3'
(R):5'- ACCTCAGACCCAGATTTCAATTTGG -3'

Posted On

2016-08-04