Incidental Mutation 'R5386:Lrp1'
ID425247
Institutional Source Beutler Lab
Gene Symbol Lrp1
Ensembl Gene ENSMUSG00000040249
Gene Namelow density lipoprotein receptor-related protein 1
SynonymsA2mr, b2b1554Clo, CD91
Accession Numbers

NCBI RefSeq: NM_008512.2; MGI:96828

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5386 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127538161-127621148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127592114 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 530 (V530E)
Ref Sequence ENSEMBL: ENSMUSP00000044004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049149] [ENSMUST00000121829]
Predicted Effect probably damaging
Transcript: ENSMUST00000049149
AA Change: V530E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044004
Gene: ENSMUSG00000040249
AA Change: V530E

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
LDLa 27 67 1.03e-15 SMART
LDLa 72 111 1.04e-11 SMART
EGF 115 150 8.78e-2 SMART
EGF_CA 151 190 4.49e-8 SMART
low complexity region 222 232 N/A INTRINSIC
LY 273 315 7.07e-6 SMART
LY 316 359 2.31e-10 SMART
LY 360 402 8.3e-12 SMART
EGF 478 521 9.93e-1 SMART
LY 552 594 8.84e-7 SMART
LY 595 638 6.54e-10 SMART
LY 641 690 2.5e-15 SMART
LY 691 734 1.06e-9 SMART
EGF 807 844 1.38e1 SMART
LDLa 854 893 3.39e-16 SMART
LDLa 895 934 1.73e-13 SMART
LDLa 936 974 4.47e-16 SMART
LDLa 976 1014 2.53e-15 SMART
LDLa 1015 1054 2.95e-16 SMART
LDLa 1062 1100 3.24e-13 SMART
LDLa 1104 1143 2.97e-12 SMART
LDLa 1145 1185 1.24e-9 SMART
EGF 1185 1223 4.97e-1 SMART
EGF 1227 1263 6.02e0 SMART
LY 1290 1332 3.76e-1 SMART
LY 1337 1379 8.56e-14 SMART
LY 1380 1424 8.43e-13 SMART
LY 1425 1469 3.05e-10 SMART
LY 1471 1513 3.88e-3 SMART
EGF 1540 1580 1.85e0 SMART
LY 1606 1650 2.83e-5 SMART
LY 1651 1695 2.01e-10 SMART
LY 1698 1735 1.87e-5 SMART
LY 1736 1777 3.54e-6 SMART
LY 1778 1820 4.17e1 SMART
EGF 1850 1888 1.24e-1 SMART
LY 1915 1957 3.2e-4 SMART
LY 1958 2000 2.33e-15 SMART
LY 2001 2044 7.45e-14 SMART
LY 2045 2087 3.87e-12 SMART
LY 2089 2131 1.37e0 SMART
EGF 2159 2196 1.66e1 SMART
LY 2276 2318 5.57e-4 SMART
LY 2324 2369 3.3e-6 SMART
LY 2370 2412 3.93e-13 SMART
LY 2413 2454 3.62e-3 SMART
EGF_like 2482 2519 3.16e1 SMART
LDLa 2524 2564 3.31e-10 SMART
LDLa 2566 2603 7.21e-11 SMART
LDLa 2605 2642 1.09e-10 SMART
LDLa 2660 2691 6.05e-4 SMART
LDLa 2696 2733 2.49e-14 SMART
LDLa 2734 2772 4.65e-14 SMART
LDLa 2774 2815 3.92e-12 SMART
LDLa 2818 2856 1.51e-13 SMART
LDLa 2858 2900 1.93e-11 SMART
LDLa 2904 2942 1.73e-13 SMART
EGF_CA 2941 2982 6.16e-6 SMART
EGF_CA 2983 3023 2.66e-10 SMART
LY 3050 3094 6.64e-11 SMART
LY 3095 3137 7.17e-16 SMART
LY 3138 3181 4.28e-14 SMART
LY 3182 3224 8.11e-15 SMART
LY 3225 3265 1.44e-6 SMART
EGF 3294 3332 1.02e-2 SMART
LDLa 3334 3372 2.25e-12 SMART
LDLa 3374 3411 9.81e-13 SMART
LDLa 3413 3451 9.81e-13 SMART
LDLa 3453 3492 5.67e-18 SMART
LDLa 3494 3534 7.15e-15 SMART
LDLa 3536 3573 1.79e-15 SMART
EGF_like 3575 3611 4.83e1 SMART
LDLa 3575 3612 1.92e-15 SMART
LDLa 3613 3650 1.18e-15 SMART
LDLa 3654 3693 7.55e-14 SMART
LDLa 3695 3734 1.14e-8 SMART
LDLa 3741 3779 6.28e-11 SMART
EGF 3785 3824 1.06e1 SMART
EGF 3828 3862 1.51e0 SMART
LY 3893 3935 9.43e0 SMART
LY 3951 3993 1.23e-14 SMART
LY 3994 4037 2.98e-13 SMART
LY 4038 4080 4.28e-14 SMART
EGF 4151 4184 3.76e-1 SMART
low complexity region 4185 4198 N/A INTRINSIC
EGF 4200 4233 3.82e-2 SMART
EGF 4236 4269 4.03e-1 SMART
EGF 4272 4305 5.2e-4 SMART
EGF 4308 4341 1.22e0 SMART
EGF_like 4344 4376 4.11e1 SMART
EGF 4377 4410 5.12e-3 SMART
transmembrane domain 4423 4445 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121829
AA Change: V530E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113584
Gene: ENSMUSG00000040249
AA Change: V530E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 67 1.03e-15 SMART
LDLa 72 111 1.04e-11 SMART
EGF 115 150 8.78e-2 SMART
EGF_CA 151 190 4.49e-8 SMART
low complexity region 222 232 N/A INTRINSIC
LY 273 315 7.07e-6 SMART
LY 316 359 2.31e-10 SMART
LY 360 402 8.3e-12 SMART
EGF 478 521 9.93e-1 SMART
LY 552 594 8.84e-7 SMART
LY 595 638 6.54e-10 SMART
LY 641 690 2.5e-15 SMART
LY 691 734 1.06e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125480
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype Strain: 2178192
Lethality: E10-E13
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor family of proteins. The encoded preproprotein is proteolytically processed by furin to generate 515 kDa and 85 kDa subunits that form the mature receptor (PMID: 8546712). This receptor is involved in several cellular processes, including intracellular signaling, lipid homeostasis, and clearance of apoptotic cells. In addition, the encoded protein is necessary for the alpha 2-macroglobulin-mediated clearance of secreted amyloid precursor protein and beta-amyloid, the main component of amyloid plaques found in Alzheimer patients. Expression of this gene decreases with age and has been found to be lower than controls in brain tissue from Alzheimer's disease patients. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality during late organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(42) : Targeted(9) Gene trapped(33)

Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,194,413 G887R probably damaging Het
4931406P16Rik A G 7: 34,242,388 F120L probably damaging Het
Abcc12 T G 8: 86,517,489 K1012Q possibly damaging Het
Afmid G A 11: 117,828,142 G33R probably benign Het
Agbl3 G T 6: 34,799,196 W207C probably damaging Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Ak2 T C 4: 129,008,172 S213P probably benign Het
Alk T A 17: 71,875,012 N1339Y probably damaging Het
Angpt1 T C 15: 42,438,365 S416G probably damaging Het
Ank2 C T 3: 126,981,933 V854M probably benign Het
Ankrd61 G T 5: 143,891,664 N122K possibly damaging Het
Armc9 T A 1: 86,198,289 L34Q probably null Het
Aspg T A 12: 112,123,032 V418E probably benign Het
Baz1b C T 5: 135,238,059 R1241C probably damaging Het
Bclaf1 T C 10: 20,325,592 V201A possibly damaging Het
C1ql3 A T 2: 13,004,358 D225E probably damaging Het
Capn9 A G 8: 124,605,540 T417A possibly damaging Het
Card14 C T 11: 119,317,289 R62C probably damaging Het
Cc2d2a A G 5: 43,730,041 N1271S probably benign Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cdv3 T C 9: 103,355,230 K133R possibly damaging Het
Cep128 A C 12: 90,999,571 S1087R probably benign Het
Cep70 T A 9: 99,281,075 L325Q probably damaging Het
Chit1 T G 1: 134,149,454 F332V probably damaging Het
Chodl C A 16: 78,946,697 T219K probably damaging Het
Cntn4 T C 6: 106,181,804 L10P possibly damaging Het
Copg1 G T 6: 87,890,207 M87I possibly damaging Het
Cyp3a59 A G 5: 146,085,768 Y28C probably benign Het
Dchs1 A C 7: 105,758,029 V2119G probably damaging Het
Dedd T C 1: 171,338,383 L23P probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnah9 T C 11: 66,029,356 N2237S probably damaging Het
Drosha A G 15: 12,842,121 I337V probably benign Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp11 T C 6: 85,947,605 *322W probably null Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Ears2 G C 7: 122,044,377 T426S probably benign Het
Elmo1 T C 13: 20,600,210 Y646H probably benign Het
Eps15 T A 4: 109,321,225 I220K possibly damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam171a2 C A 11: 102,437,867 V689L possibly damaging Het
Fam213b T A 4: 154,899,005 M1L probably benign Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fancg G A 4: 43,007,076 Q234* probably null Het
Gid4 T A 11: 60,432,442 probably null Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gm7361 A C 5: 26,258,905 T53P probably benign Het
Golgb1 T A 16: 36,912,315 C641* probably null Het
Gon4l T A 3: 88,858,496 M409K probably benign Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gpr156 T A 16: 37,948,309 V64E possibly damaging Het
Grid2 T A 6: 63,931,105 I243K probably damaging Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hdac5 T C 11: 102,202,141 E590G possibly damaging Het
Herc3 T A 6: 58,874,278 M504K probably damaging Het
Hif1a A G 12: 73,944,093 E713G probably benign Het
Hmx3 A G 7: 131,544,304 D247G probably damaging Het
Hoxd11 G T 2: 74,682,819 E143* probably null Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Il17f T C 1: 20,777,957 Q99R probably benign Het
Itga6 T A 2: 71,841,150 S341R probably damaging Het
Itgam A G 7: 128,107,980 N661S probably benign Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kcnh8 T A 17: 52,725,995 N103K probably benign Het
Kdm6b T C 11: 69,400,810 probably benign Het
Keg1 A C 19: 12,714,538 N63T probably damaging Het
Klf12 T A 14: 99,900,159 H317L probably damaging Het
Mrgpra6 A G 7: 47,188,881 C190R probably damaging Het
Myo1a G T 10: 127,705,897 E102* probably null Het
Napa A T 7: 16,116,472 E265D probably benign Het
Ncam1 A C 9: 49,564,874 V305G probably damaging Het
Nek8 T C 11: 78,170,437 probably null Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1242 G T 2: 89,494,137 Y58* probably null Het
Olfr1275 T C 2: 111,231,194 T200A probably benign Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Olfr243 T C 7: 103,717,355 F254L probably benign Het
Olfr251 A T 9: 38,377,985 I29F probably benign Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Olfr971 A G 9: 39,839,830 Y132C possibly damaging Het
Olfr987 T C 2: 85,331,635 T88A probably benign Het
Pabpc4 A G 4: 123,294,997 Q417R probably benign Het
Panx3 A T 9: 37,669,024 M11K probably damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pi4k2a G A 19: 42,090,515 S5N probably damaging Het
Plag1 T A 4: 3,904,075 Q372L probably benign Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pld4 G T 12: 112,763,988 E102* probably null Het
Pnlip A G 19: 58,679,607 N345S probably benign Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Ptch1 A G 13: 63,545,043 Y181H probably damaging Het
Reln A G 5: 22,039,529 V817A probably benign Het
Rictor C A 15: 6,789,504 Q1403K probably benign Het
Rims1 T A 1: 22,412,245 I882F probably damaging Het
Rnf19a A G 15: 36,242,039 V618A probably benign Het
Ryr1 A T 7: 29,117,416 I65N probably damaging Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Serpine2 A T 1: 79,821,287 Y83* probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc14a2 T A 18: 78,185,840 D306V possibly damaging Het
Slc4a10 A T 2: 62,290,058 E843V probably damaging Het
Smyd4 T A 11: 75,390,156 C152S probably damaging Het
Snx10 T C 6: 51,575,972 Y32H probably damaging Het
Sorl1 T C 9: 42,057,284 T558A possibly damaging Het
Spata31d1b G A 13: 59,719,052 C1338Y possibly damaging Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Tecpr2 T C 12: 110,915,453 V152A probably damaging Het
Tedc1 T C 12: 113,156,682 V47A probably benign Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tgm4 A G 9: 123,056,494 Y367C probably damaging Het
Tle1 C T 4: 72,141,844 V258M probably damaging Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tmco2 A G 4: 121,105,984 L106P probably damaging Het
Tmem131 A T 1: 36,872,558 C103S possibly damaging Het
Tmprss7 T A 16: 45,669,528 I444F possibly damaging Het
Trank1 T C 9: 111,362,402 V493A probably benign Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Tulp4 T A 17: 6,236,293 V1532D probably damaging Het
Ubqlnl T G 7: 104,149,217 I358L probably benign Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vps13b A T 15: 35,640,528 probably null Het
Vwa3a A G 7: 120,790,142 K68E possibly damaging Het
Zfp746 G T 6: 48,064,176 H538N possibly damaging Het
Other mutations in Lrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Lrp1 APN 10 127542205 missense possibly damaging 0.89
IGL01065:Lrp1 APN 10 127575038 missense probably benign 0.10
IGL01121:Lrp1 APN 10 127583853 nonsense probably null
IGL01360:Lrp1 APN 10 127545820 missense possibly damaging 0.93
IGL01402:Lrp1 APN 10 127595032 missense probably damaging 1.00
IGL01404:Lrp1 APN 10 127595032 missense probably damaging 1.00
IGL01411:Lrp1 APN 10 127581765 nonsense probably null
IGL01469:Lrp1 APN 10 127584414 missense probably damaging 1.00
IGL01552:Lrp1 APN 10 127588510 nonsense probably null
IGL01682:Lrp1 APN 10 127574978 missense probably benign 0.00
IGL01760:Lrp1 APN 10 127573501 missense probably benign 0.00
IGL01918:Lrp1 APN 10 127554589 missense probably damaging 0.99
IGL01989:Lrp1 APN 10 127578129 missense probably damaging 1.00
IGL02105:Lrp1 APN 10 127544579 missense probably damaging 1.00
IGL02158:Lrp1 APN 10 127554271 missense probably benign 0.02
IGL02164:Lrp1 APN 10 127563667 missense probably benign 0.39
IGL02337:Lrp1 APN 10 127576887 missense possibly damaging 0.87
IGL02425:Lrp1 APN 10 127571887 critical splice donor site probably null
IGL02493:Lrp1 APN 10 127581778 missense probably damaging 0.99
IGL02563:Lrp1 APN 10 127551686 missense probably damaging 1.00
IGL02590:Lrp1 APN 10 127552791 missense probably damaging 1.00
IGL02624:Lrp1 APN 10 127572422 missense probably damaging 0.98
IGL02625:Lrp1 APN 10 127574486 missense probably damaging 1.00
IGL02825:Lrp1 APN 10 127542605 missense probably damaging 1.00
IGL02880:Lrp1 APN 10 127540222 missense probably benign 0.12
IGL02900:Lrp1 APN 10 127576647 splice site probably benign
IGL02956:Lrp1 APN 10 127544559 missense probably benign 0.00
IGL02974:Lrp1 APN 10 127555016 missense probably damaging 0.99
IGL02983:Lrp1 APN 10 127550199 missense probably damaging 1.00
IGL03002:Lrp1 APN 10 127589636 missense probably damaging 1.00
IGL03091:Lrp1 APN 10 127559124 missense probably benign 0.30
IGL03109:Lrp1 APN 10 127566645 missense probably benign
IGL03194:Lrp1 APN 10 127568685 missense probably damaging 1.00
IGL03232:Lrp1 APN 10 127539376 missense probably damaging 1.00
peripheral UTSW 10 127610381 missense probably damaging 1.00
tangential UTSW 10 127593848 missense probably damaging 0.99
P0015:Lrp1 UTSW 10 127566663 missense probably damaging 0.99
PIT4519001:Lrp1 UTSW 10 127607974 missense possibly damaging 0.91
PIT4520001:Lrp1 UTSW 10 127607974 missense possibly damaging 0.91
R0004:Lrp1 UTSW 10 127541825 splice site probably null
R0034:Lrp1 UTSW 10 127545651 missense probably benign 0.42
R0091:Lrp1 UTSW 10 127540979 missense probably damaging 1.00
R0098:Lrp1 UTSW 10 127552738 missense probably benign
R0098:Lrp1 UTSW 10 127552738 missense probably benign
R0143:Lrp1 UTSW 10 127593942 missense probably damaging 1.00
R0372:Lrp1 UTSW 10 127592136 missense probably damaging 1.00
R0379:Lrp1 UTSW 10 127594969 missense probably damaging 1.00
R0445:Lrp1 UTSW 10 127590636 nonsense probably null
R0529:Lrp1 UTSW 10 127541594 intron probably null
R0551:Lrp1 UTSW 10 127571958 missense probably benign
R0570:Lrp1 UTSW 10 127555009 nonsense probably null
R0600:Lrp1 UTSW 10 127567383 missense probably benign 0.00
R0626:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R0647:Lrp1 UTSW 10 127571477 missense probably damaging 1.00
R0680:Lrp1 UTSW 10 127589661 missense probably damaging 1.00
R0792:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R0792:Lrp1 UTSW 10 127575286 missense probably benign 0.04
R0848:Lrp1 UTSW 10 127553362 splice site probably null
R0866:Lrp1 UTSW 10 127539278 missense probably damaging 1.00
R0918:Lrp1 UTSW 10 127593965 missense probably damaging 1.00
R1076:Lrp1 UTSW 10 127563797 splice site probably benign
R1107:Lrp1 UTSW 10 127557435 missense probably damaging 1.00
R1346:Lrp1 UTSW 10 127605866 missense probably damaging 1.00
R1403:Lrp1 UTSW 10 127581891 critical splice acceptor site probably null
R1403:Lrp1 UTSW 10 127581891 critical splice acceptor site probably null
R1496:Lrp1 UTSW 10 127539011 missense probably damaging 1.00
R1522:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R1522:Lrp1 UTSW 10 127575286 missense probably benign 0.04
R1525:Lrp1 UTSW 10 127539529 missense probably damaging 1.00
R1539:Lrp1 UTSW 10 127584381 unclassified probably null
R1589:Lrp1 UTSW 10 127605606 missense probably benign 0.00
R1591:Lrp1 UTSW 10 127605606 missense probably benign 0.00
R1663:Lrp1 UTSW 10 127556921 missense probably damaging 1.00
R1682:Lrp1 UTSW 10 127574332 missense probably damaging 1.00
R1717:Lrp1 UTSW 10 127556269 missense possibly damaging 0.59
R1717:Lrp1 UTSW 10 127563665 missense probably damaging 1.00
R1758:Lrp1 UTSW 10 127588584 missense possibly damaging 0.76
R1826:Lrp1 UTSW 10 127553707 missense probably damaging 1.00
R1842:Lrp1 UTSW 10 127573468 missense possibly damaging 0.93
R1844:Lrp1 UTSW 10 127595283 critical splice donor site probably null
R1845:Lrp1 UTSW 10 127578673 missense probably damaging 1.00
R1896:Lrp1 UTSW 10 127559998 missense possibly damaging 0.64
R1952:Lrp1 UTSW 10 127567431 missense probably damaging 1.00
R2009:Lrp1 UTSW 10 127544516 missense probably damaging 1.00
R2015:Lrp1 UTSW 10 127540694 missense probably benign 0.00
R2116:Lrp1 UTSW 10 127576493 nonsense probably null
R2161:Lrp1 UTSW 10 127555738 missense probably damaging 1.00
R2199:Lrp1 UTSW 10 127546840 missense probably damaging 1.00
R2213:Lrp1 UTSW 10 127540702 missense probably damaging 1.00
R2300:Lrp1 UTSW 10 127556915 nonsense probably null
R2324:Lrp1 UTSW 10 127566586 missense possibly damaging 0.92
R2849:Lrp1 UTSW 10 127542296 missense probably damaging 1.00
R2926:Lrp1 UTSW 10 127588113 missense probably damaging 0.98
R2993:Lrp1 UTSW 10 127610381 missense probably damaging 1.00
R3522:Lrp1 UTSW 10 127553555 missense probably damaging 1.00
R3702:Lrp1 UTSW 10 127595103 missense probably damaging 1.00
R3789:Lrp1 UTSW 10 127571969 missense possibly damaging 0.94
R3898:Lrp1 UTSW 10 127592100 nonsense probably null
R3941:Lrp1 UTSW 10 127553396 missense probably damaging 1.00
R3958:Lrp1 UTSW 10 127571958 missense probably benign
R4369:Lrp1 UTSW 10 127550286 missense possibly damaging 0.87
R4510:Lrp1 UTSW 10 127593848 missense probably damaging 0.99
R4511:Lrp1 UTSW 10 127593848 missense probably damaging 0.99
R4576:Lrp1 UTSW 10 127540188 small deletion probably benign
R4583:Lrp1 UTSW 10 127541372 missense probably benign 0.00
R4662:Lrp1 UTSW 10 127552185 nonsense probably null
R4721:Lrp1 UTSW 10 127555059 missense possibly damaging 0.58
R4728:Lrp1 UTSW 10 127563737 missense probably damaging 1.00
R4745:Lrp1 UTSW 10 127549944 missense probably benign 0.20
R4785:Lrp1 UTSW 10 127558133 missense probably benign 0.12
R4841:Lrp1 UTSW 10 127583936 missense probably damaging 1.00
R4842:Lrp1 UTSW 10 127583936 missense probably damaging 1.00
R4855:Lrp1 UTSW 10 127610442 missense probably benign 0.03
R4860:Lrp1 UTSW 10 127553824 missense probably damaging 1.00
R4860:Lrp1 UTSW 10 127553824 missense probably damaging 1.00
R4891:Lrp1 UTSW 10 127541752 missense probably damaging 1.00
R4925:Lrp1 UTSW 10 127575075 nonsense probably null
R4970:Lrp1 UTSW 10 127539520 missense probably benign 0.11
R4999:Lrp1 UTSW 10 127553779 missense probably damaging 1.00
R5044:Lrp1 UTSW 10 127567495 missense probably damaging 1.00
R5127:Lrp1 UTSW 10 127539634 intron probably benign
R5188:Lrp1 UTSW 10 127607952 missense probably damaging 1.00
R5218:Lrp1 UTSW 10 127548619 missense probably damaging 1.00
R5225:Lrp1 UTSW 10 127556096 missense probably benign 0.04
R5291:Lrp1 UTSW 10 127593878 missense probably damaging 1.00
R5395:Lrp1 UTSW 10 127595297 missense probably damaging 1.00
R5413:Lrp1 UTSW 10 127588067 critical splice donor site probably null
R5430:Lrp1 UTSW 10 127541061 missense probably damaging 0.99
R5499:Lrp1 UTSW 10 127572944 missense possibly damaging 0.58
R5526:Lrp1 UTSW 10 127555724 missense probably benign 0.37
R5580:Lrp1 UTSW 10 127588520 missense probably benign
R5583:Lrp1 UTSW 10 127588463 missense probably benign 0.08
R5599:Lrp1 UTSW 10 127593869 missense probably damaging 1.00
R5639:Lrp1 UTSW 10 127593839 missense probably damaging 0.99
R5677:Lrp1 UTSW 10 127574429 missense probably damaging 1.00
R5730:Lrp1 UTSW 10 127583834 missense probably benign 0.00
R5742:Lrp1 UTSW 10 127548347 missense probably damaging 0.98
R5764:Lrp1 UTSW 10 127595318 missense probably benign 0.41
R5864:Lrp1 UTSW 10 127567505 missense possibly damaging 0.58
R5937:Lrp1 UTSW 10 127583876 missense possibly damaging 0.93
R5947:Lrp1 UTSW 10 127589554 critical splice donor site probably null
R5976:Lrp1 UTSW 10 127583901 missense probably damaging 1.00
R6021:Lrp1 UTSW 10 127578014 missense probably damaging 1.00
R6026:Lrp1 UTSW 10 127573403 missense probably damaging 1.00
R6045:Lrp1 UTSW 10 127566600 missense probably damaging 0.98
R6057:Lrp1 UTSW 10 127567490 missense probably damaging 1.00
R6084:Lrp1 UTSW 10 127560553 missense probably benign 0.09
R6131:Lrp1 UTSW 10 127560157 missense probably benign
R6235:Lrp1 UTSW 10 127588177 missense probably damaging 1.00
R6280:Lrp1 UTSW 10 127589584 missense probably benign 0.04
R6307:Lrp1 UTSW 10 127592075 missense probably damaging 1.00
R6532:Lrp1 UTSW 10 127541682 missense probably damaging 1.00
R6532:Lrp1 UTSW 10 127549407 missense probably damaging 1.00
R6536:Lrp1 UTSW 10 127558068 splice site probably null
R6605:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6607:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6631:Lrp1 UTSW 10 127574332 missense probably damaging 1.00
R6676:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6678:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6809:Lrp1 UTSW 10 127555056 missense probably benign 0.04
R6884:Lrp1 UTSW 10 127559117 missense probably benign 0.00
R6925:Lrp1 UTSW 10 127556988 missense probably benign 0.00
R6987:Lrp1 UTSW 10 127575005 missense probably damaging 1.00
R7016:Lrp1 UTSW 10 127559967 critical splice donor site probably null
R7030:Lrp1 UTSW 10 127552876 missense probably damaging 0.97
R7053:Lrp1 UTSW 10 127541094 missense probably damaging 1.00
R7076:Lrp1 UTSW 10 127550183 critical splice donor site probably null
R7136:Lrp1 UTSW 10 127558622 missense probably damaging 1.00
R7180:Lrp1 UTSW 10 127556965 missense probably damaging 1.00
R7199:Lrp1 UTSW 10 127573456 missense probably damaging 0.99
R7219:Lrp1 UTSW 10 127557228 missense probably benign 0.40
R7233:Lrp1 UTSW 10 127595061 missense probably damaging 1.00
R7251:Lrp1 UTSW 10 127572554 missense probably damaging 1.00
R7264:Lrp1 UTSW 10 127592093 missense probably damaging 1.00
R7302:Lrp1 UTSW 10 127538987 missense probably benign 0.01
R7313:Lrp1 UTSW 10 127553468 missense probably damaging 1.00
R7322:Lrp1 UTSW 10 127545564 missense probably benign 0.24
R7354:Lrp1 UTSW 10 127571408 missense probably damaging 1.00
R7375:Lrp1 UTSW 10 127539348 missense probably damaging 1.00
R7388:Lrp1 UTSW 10 127583897 nonsense probably null
R7404:Lrp1 UTSW 10 127582708 missense
R7405:Lrp1 UTSW 10 127581751 missense possibly damaging 0.93
R7477:Lrp1 UTSW 10 127568920 missense probably damaging 1.00
R7555:Lrp1 UTSW 10 127546862 missense probably damaging 1.00
R7600:Lrp1 UTSW 10 127555706 missense probably benign
R7678:Lrp1 UTSW 10 127574053 missense probably damaging 1.00
R7679:Lrp1 UTSW 10 127588428 nonsense probably null
V3553:Lrp1 UTSW 10 127571442 missense probably damaging 1.00
Y5406:Lrp1 UTSW 10 127554283 missense probably damaging 1.00
Z1088:Lrp1 UTSW 10 127584379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCTGGCGGCCAATGAGG -3'
(R):5'- GCACCTCAGACCCAGATTTC -3'

Sequencing Primer
(F):5'- CGGCCAATGAGGTAGCTG -3'
(R):5'- ACCTCAGACCCAGATTTCAATTTGG -3'
Posted On2016-08-04