Incidental Mutation 'R5386:Smyd4'
ID 425252
Institutional Source Beutler Lab
Gene Symbol Smyd4
Ensembl Gene ENSMUSG00000018809
Gene Name SET and MYND domain containing 4
Synonyms G430029E23Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5386 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 75239259-75296531 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75280982 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 152 (C152S)
Ref Sequence ENSEMBL: ENSMUSP00000047505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044530]
AlphaFold Q8BTK5
Predicted Effect probably damaging
Transcript: ENSMUST00000044530
AA Change: C152S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047505
Gene: ENSMUSG00000018809
AA Change: C152S

DomainStartEndE-ValueType
Pfam:TPR_11 65 132 2.4e-10 PFAM
SET 231 576 4.85e-1 SMART
Blast:TPR 694 726 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145888
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit testicular degeneration and atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T G 8: 87,244,118 (GRCm39) K1012Q possibly damaging Het
Afmid G A 11: 117,718,968 (GRCm39) G33R probably benign Het
Agbl3 G T 6: 34,776,131 (GRCm39) W207C probably damaging Het
Ajuba T C 14: 54,807,855 (GRCm39) Y459C probably damaging Het
Ak2 T C 4: 128,901,965 (GRCm39) S213P probably benign Het
Alk T A 17: 72,182,007 (GRCm39) N1339Y probably damaging Het
Angpt1 T C 15: 42,301,761 (GRCm39) S416G probably damaging Het
Ank2 C T 3: 126,775,582 (GRCm39) V854M probably benign Het
Ankrd61 G T 5: 143,828,482 (GRCm39) N122K possibly damaging Het
Armc9 T A 1: 86,126,011 (GRCm39) L34Q probably null Het
Aspg T A 12: 112,089,466 (GRCm39) V418E probably benign Het
Baz1b C T 5: 135,266,913 (GRCm39) R1241C probably damaging Het
Bclaf1 T C 10: 20,201,338 (GRCm39) V201A possibly damaging Het
C1ql3 A T 2: 13,009,169 (GRCm39) D225E probably damaging Het
Capn9 A G 8: 125,332,279 (GRCm39) T417A possibly damaging Het
Card14 C T 11: 119,208,115 (GRCm39) R62C probably damaging Het
Cc2d2a A G 5: 43,887,383 (GRCm39) N1271S probably benign Het
Ccpg1 G A 9: 72,920,326 (GRCm39) S647N probably benign Het
Cdv3 T C 9: 103,232,429 (GRCm39) K133R possibly damaging Het
Cep128 A C 12: 90,966,345 (GRCm39) S1087R probably benign Het
Cep70 T A 9: 99,163,128 (GRCm39) L325Q probably damaging Het
Chit1 T G 1: 134,077,192 (GRCm39) F332V probably damaging Het
Chodl C A 16: 78,743,585 (GRCm39) T219K probably damaging Het
Cntn4 T C 6: 106,158,765 (GRCm39) L10P possibly damaging Het
Copg1 G T 6: 87,867,189 (GRCm39) M87I possibly damaging Het
Cplane1 G A 15: 8,223,897 (GRCm39) G887R probably damaging Het
Cyp3a59 A G 5: 146,022,578 (GRCm39) Y28C probably benign Het
Dchs1 A C 7: 105,407,236 (GRCm39) V2119G probably damaging Het
Dedd T C 1: 171,165,951 (GRCm39) L23P probably damaging Het
Dmxl2 A G 9: 54,286,041 (GRCm39) S2715P probably benign Het
Dnah9 T C 11: 65,920,182 (GRCm39) N2237S probably damaging Het
Drosha A G 15: 12,842,207 (GRCm39) I337V probably benign Het
Duox2 A G 2: 122,125,617 (GRCm39) V330A probably benign Het
Dusp11 T C 6: 85,924,587 (GRCm39) *322W probably null Het
Dusp8 T A 7: 141,643,730 (GRCm39) Q61L possibly damaging Het
Ears2 G C 7: 121,643,600 (GRCm39) T426S probably benign Het
Elmo1 T C 13: 20,784,380 (GRCm39) Y646H probably benign Het
Eps15 T A 4: 109,178,422 (GRCm39) I220K possibly damaging Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Fam171a2 C A 11: 102,328,693 (GRCm39) V689L possibly damaging Het
Fam91a1 G A 15: 58,320,243 (GRCm39) S645N probably benign Het
Fancg G A 4: 43,007,076 (GRCm39) Q234* probably null Het
Garre1 A G 7: 33,941,813 (GRCm39) F120L probably damaging Het
Gid4 T A 11: 60,323,268 (GRCm39) probably null Het
Gm7361 A C 5: 26,463,903 (GRCm39) T53P probably benign Het
Golgb1 T A 16: 36,732,677 (GRCm39) C641* probably null Het
Gon4l T A 3: 88,765,803 (GRCm39) M409K probably benign Het
Gpatch8 A T 11: 102,399,053 (GRCm39) probably null Het
Gpr156 T A 16: 37,768,671 (GRCm39) V64E possibly damaging Het
Grid2 T A 6: 63,908,089 (GRCm39) I243K probably damaging Het
Gucy2g G A 19: 55,203,548 (GRCm39) A750V probably damaging Het
Hdac5 T C 11: 102,092,967 (GRCm39) E590G possibly damaging Het
Herc3 T A 6: 58,851,263 (GRCm39) M504K probably damaging Het
Hif1a A G 12: 73,990,867 (GRCm39) E713G probably benign Het
Hmx3 A G 7: 131,146,033 (GRCm39) D247G probably damaging Het
Hoxd11 G T 2: 74,513,163 (GRCm39) E143* probably null Het
Ifitm3 T C 7: 140,590,554 (GRCm39) N2S probably benign Het
Il17f T C 1: 20,848,181 (GRCm39) Q99R probably benign Het
Itga6 T A 2: 71,671,494 (GRCm39) S341R probably damaging Het
Itgam A G 7: 127,707,152 (GRCm39) N661S probably benign Het
Jag1 A T 2: 136,937,464 (GRCm39) H303Q possibly damaging Het
Kcnh8 T A 17: 53,033,023 (GRCm39) N103K probably benign Het
Kdm6b T C 11: 69,291,636 (GRCm39) probably benign Het
Keg1 A C 19: 12,691,902 (GRCm39) N63T probably damaging Het
Klf12 T A 14: 100,137,595 (GRCm39) H317L probably damaging Het
Lrp1 A T 10: 127,427,983 (GRCm39) V530E probably damaging Het
Mrgpra6 A G 7: 46,838,629 (GRCm39) C190R probably damaging Het
Myo1a G T 10: 127,541,766 (GRCm39) E102* probably null Het
Napa A T 7: 15,850,397 (GRCm39) E265D probably benign Het
Ncam1 A C 9: 49,476,174 (GRCm39) V305G probably damaging Het
Nek8 T C 11: 78,061,263 (GRCm39) probably null Het
Or10ag53 C T 2: 87,082,827 (GRCm39) P182L probably benign Het
Or11g24 T A 14: 50,662,846 (GRCm39) V290E possibly damaging Het
Or4a70 G T 2: 89,324,481 (GRCm39) Y58* probably null Het
Or4f52 T C 2: 111,061,539 (GRCm39) T200A probably benign Het
Or52a20 T C 7: 103,366,562 (GRCm39) F254L probably benign Het
Or5ak4 T C 2: 85,161,979 (GRCm39) T88A probably benign Het
Or5h23 T A 16: 58,906,253 (GRCm39) M198L probably benign Het
Or8c11 A T 9: 38,289,281 (GRCm39) I29F probably benign Het
Or8g2b A G 9: 39,751,126 (GRCm39) Y132C possibly damaging Het
Pabpc4 A G 4: 123,188,790 (GRCm39) Q417R probably benign Het
Panx3 A T 9: 37,580,320 (GRCm39) M11K probably damaging Het
Pcbp1 C T 6: 86,502,471 (GRCm39) E143K probably damaging Het
Pdcd7 G A 9: 65,265,974 (GRCm39) W477* probably null Het
Pi4k2a G A 19: 42,078,954 (GRCm39) S5N probably damaging Het
Plag1 T A 4: 3,904,075 (GRCm39) Q372L probably benign Het
Plce1 C A 19: 38,748,535 (GRCm39) N1755K probably damaging Het
Pld4 G T 12: 112,730,422 (GRCm39) E102* probably null Het
Pnlip A G 19: 58,668,039 (GRCm39) N345S probably benign Het
Ppm1e A T 11: 87,249,377 (GRCm39) L118Q possibly damaging Het
Prkra T G 2: 76,469,622 (GRCm39) T146P probably damaging Het
Prpf8 A G 11: 75,386,625 (GRCm39) D1038G probably damaging Het
Prss51 T A 14: 64,334,543 (GRCm39) V108E probably damaging Het
Prxl2b T A 4: 154,983,462 (GRCm39) M1L probably benign Het
Ptch1 A G 13: 63,692,857 (GRCm39) Y181H probably damaging Het
Reln A G 5: 22,244,527 (GRCm39) V817A probably benign Het
Rictor C A 15: 6,818,985 (GRCm39) Q1403K probably benign Het
Rims1 T A 1: 22,482,469 (GRCm39) I882F probably damaging Het
Rnf19a A G 15: 36,242,185 (GRCm39) V618A probably benign Het
Ryr1 A T 7: 28,816,841 (GRCm39) I65N probably damaging Het
S1pr2 T C 9: 20,878,890 (GRCm39) T313A probably benign Het
Serpine2 A T 1: 79,799,004 (GRCm39) Y83* probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,103,384 (GRCm39) probably benign Het
Sgip1 T C 4: 102,772,256 (GRCm39) V215A probably benign Het
Sgsm3 T C 15: 80,892,200 (GRCm39) V256A probably benign Het
Shroom4 T A X: 6,497,523 (GRCm39) C894* probably null Het
Slc14a2 T A 18: 78,229,055 (GRCm39) D306V possibly damaging Het
Slc28a2b C A 2: 122,353,259 (GRCm39) L480I probably benign Het
Slc4a10 A T 2: 62,120,402 (GRCm39) E843V probably damaging Het
Snx10 T C 6: 51,552,952 (GRCm39) Y32H probably damaging Het
Sorl1 T C 9: 41,968,580 (GRCm39) T558A possibly damaging Het
Spata31d1b G A 13: 59,866,866 (GRCm39) C1338Y possibly damaging Het
Sppl2c T A 11: 104,078,127 (GRCm39) I309K possibly damaging Het
Stard9 A G 2: 120,531,111 (GRCm39) E2456G probably damaging Het
Stx1b A T 7: 127,414,575 (GRCm39) D16E probably benign Het
Tecpr2 T C 12: 110,881,887 (GRCm39) V152A probably damaging Het
Tedc1 T C 12: 113,120,302 (GRCm39) V47A probably benign Het
Tep1 A T 14: 51,105,774 (GRCm39) L82Q probably damaging Het
Tgm4 A G 9: 122,885,559 (GRCm39) Y367C probably damaging Het
Tle1 C T 4: 72,060,081 (GRCm39) V258M probably damaging Het
Tm9sf1 C T 14: 55,880,301 (GRCm39) G32D possibly damaging Het
Tmco2 A G 4: 120,963,181 (GRCm39) L106P probably damaging Het
Tmem131 A T 1: 36,911,639 (GRCm39) C103S possibly damaging Het
Tmprss7 T A 16: 45,489,891 (GRCm39) I444F possibly damaging Het
Trank1 T C 9: 111,191,470 (GRCm39) V493A probably benign Het
Trim80 A T 11: 115,338,843 (GRCm39) T558S probably benign Het
Trmt6 C A 2: 132,650,703 (GRCm39) A302S probably benign Het
Ttc17 A T 2: 94,133,985 (GRCm39) W1067R probably damaging Het
Tulp4 T A 17: 6,286,568 (GRCm39) V1532D probably damaging Het
Ubqlnl T G 7: 103,798,424 (GRCm39) I358L probably benign Het
Ulk3 T A 9: 57,498,023 (GRCm39) I108N possibly damaging Het
Vps13b A T 15: 35,640,674 (GRCm39) probably null Het
Vwa3a A G 7: 120,389,365 (GRCm39) K68E possibly damaging Het
Zfp746 G T 6: 48,041,110 (GRCm39) H538N possibly damaging Het
Other mutations in Smyd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Smyd4 APN 11 75,281,634 (GRCm39) missense probably benign
IGL02372:Smyd4 APN 11 75,281,111 (GRCm39) nonsense probably null
IGL02390:Smyd4 APN 11 75,278,332 (GRCm39) splice site probably null
IGL02492:Smyd4 APN 11 75,294,252 (GRCm39) missense probably benign
IGL02504:Smyd4 APN 11 75,281,507 (GRCm39) missense probably damaging 1.00
IGL02623:Smyd4 APN 11 75,280,890 (GRCm39) splice site probably benign
IGL02661:Smyd4 APN 11 75,281,767 (GRCm39) nonsense probably null
IGL03084:Smyd4 APN 11 75,281,433 (GRCm39) missense probably benign 0.00
PIT4431001:Smyd4 UTSW 11 75,294,339 (GRCm39) missense probably damaging 1.00
R0507:Smyd4 UTSW 11 75,290,534 (GRCm39) missense possibly damaging 0.69
R0834:Smyd4 UTSW 11 75,281,958 (GRCm39) missense possibly damaging 0.94
R1075:Smyd4 UTSW 11 75,291,164 (GRCm39) missense probably damaging 1.00
R1215:Smyd4 UTSW 11 75,281,121 (GRCm39) missense possibly damaging 0.96
R1759:Smyd4 UTSW 11 75,273,192 (GRCm39) missense probably damaging 1.00
R2496:Smyd4 UTSW 11 75,281,927 (GRCm39) missense probably benign 0.03
R2862:Smyd4 UTSW 11 75,280,962 (GRCm39) missense probably benign 0.12
R4033:Smyd4 UTSW 11 75,240,580 (GRCm39) missense probably benign 0.06
R4655:Smyd4 UTSW 11 75,281,558 (GRCm39) missense probably damaging 1.00
R4775:Smyd4 UTSW 11 75,282,018 (GRCm39) missense probably damaging 1.00
R4801:Smyd4 UTSW 11 75,294,010 (GRCm39) missense probably damaging 1.00
R4802:Smyd4 UTSW 11 75,294,010 (GRCm39) missense probably damaging 1.00
R4963:Smyd4 UTSW 11 75,273,120 (GRCm39) missense probably benign 0.01
R5306:Smyd4 UTSW 11 75,292,984 (GRCm39) missense probably benign 0.00
R5327:Smyd4 UTSW 11 75,281,765 (GRCm39) missense probably damaging 1.00
R5578:Smyd4 UTSW 11 75,295,602 (GRCm39) missense probably benign 0.03
R7038:Smyd4 UTSW 11 75,281,340 (GRCm39) missense probably damaging 1.00
R7271:Smyd4 UTSW 11 75,281,325 (GRCm39) missense possibly damaging 0.90
R7312:Smyd4 UTSW 11 75,281,082 (GRCm39) missense probably benign 0.18
R7576:Smyd4 UTSW 11 75,281,032 (GRCm39) missense probably benign 0.03
R7904:Smyd4 UTSW 11 75,240,613 (GRCm39) missense possibly damaging 0.80
R8387:Smyd4 UTSW 11 75,292,984 (GRCm39) missense probably benign 0.00
R8816:Smyd4 UTSW 11 75,281,232 (GRCm39) missense probably benign 0.24
R9235:Smyd4 UTSW 11 75,295,689 (GRCm39) missense probably benign 0.00
R9436:Smyd4 UTSW 11 75,293,017 (GRCm39) missense probably damaging 1.00
R9786:Smyd4 UTSW 11 75,281,625 (GRCm39) missense probably benign 0.06
Z1176:Smyd4 UTSW 11 75,290,440 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TAAGCTCTCGACTGAAGTTGTC -3'
(R):5'- TCGAAGGCATTGGTGAGAGC -3'

Sequencing Primer
(F):5'- GAAGTTGTCCACTTTTAATGACCC -3'
(R):5'- GCATTGGTGAGAGCTGCAG -3'
Posted On 2016-08-04