Mutagenetix > Incidental Mutation

Incidental Mutation 'R5386:Ptch1'

425272

Institutional Source

Beutler Lab

Gene Symbol

Ptch1

Ensembl Gene

ENSMUSG00000021466

Gene Name

patched 1

Synonyms

A230106A15Rik, Patched 1, Ptc1, Ptc

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5386 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63508328-63573598 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63545043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 181 (Y181H)

Ref Sequence

ENSEMBL: ENSMUSP00000141766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000193953] [ENSMUST00000194663] [ENSMUST00000195106] [ENSMUST00000195258] [ENSMUST00000195756]

AlphaFold

Q61115

Predicted Effect

probably benign
Transcript: ENSMUST00000021921
AA Change: Y233H

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: Y233H

Domain	Start	End	E-Value	Type
low complexity region	4	30	N/A	INTRINSIC
Pfam:Patched	351	871	7.6e-47	PFAM
Pfam:Sterol-sensing	448	602	1.5e-45	PFAM
Pfam:Patched	952	1166	9.8e-33	PFAM
low complexity region	1180	1189	N/A	INTRINSIC
low complexity region	1204	1213	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1355	1367	N/A	INTRINSIC
low complexity region	1369	1384	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192155
AA Change: Y96H

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: Y96H

Domain	Start	End	E-Value	Type
Pfam:Patched	214	733	3.1e-44	PFAM
Pfam:Sterol-sensing	311	465	2.8e-46	PFAM
Pfam:Patched	814	1029	3.1e-30	PFAM
low complexity region	1043	1052	N/A	INTRINSIC
low complexity region	1067	1076	N/A	INTRINSIC
low complexity region	1144	1159	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1232	1247	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193953
AA Change: Y96H

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

probably damaging
Transcript: ENSMUST00000194663
AA Change: Y181H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466
AA Change: Y181H

Domain	Start	End	E-Value	Type
Pfam:Patched	298	569	4.7e-34	PFAM
Pfam:Sterol-sensing	396	550	7.9e-47	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195106
AA Change: Y248H

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000141298
Gene: ENSMUSG00000021466
AA Change: Y248H

Domain	Start	End	E-Value	Type
low complexity region	38	59	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000195258

SMART Domains

Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	212	426	7.8e-28	PFAM
Pfam:Sterol-sensing	311	426	8e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195756
AA Change: Y96H

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220588

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 134 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,194,413	G887R	probably damaging	Het
4931406P16Rik	A	G	7: 34,242,388	F120L	probably damaging	Het
Abcc12	T	G	8: 86,517,489	K1012Q	possibly damaging	Het
Afmid	G	A	11: 117,828,142	G33R	probably benign	Het
Agbl3	G	T	6: 34,799,196	W207C	probably damaging	Het
Ajuba	T	C	14: 54,570,398	Y459C	probably damaging	Het
Ak2	T	C	4: 129,008,172	S213P	probably benign	Het
Alk	T	A	17: 71,875,012	N1339Y	probably damaging	Het
Angpt1	T	C	15: 42,438,365	S416G	probably damaging	Het
Ank2	C	T	3: 126,981,933	V854M	probably benign	Het
Ankrd61	G	T	5: 143,891,664	N122K	possibly damaging	Het
Armc9	T	A	1: 86,198,289	L34Q	probably null	Het
Aspg	T	A	12: 112,123,032	V418E	probably benign	Het
Baz1b	C	T	5: 135,238,059	R1241C	probably damaging	Het
Bclaf1	T	C	10: 20,325,592	V201A	possibly damaging	Het
C1ql3	A	T	2: 13,004,358	D225E	probably damaging	Het
Capn9	A	G	8: 124,605,540	T417A	possibly damaging	Het
Card14	C	T	11: 119,317,289	R62C	probably damaging	Het
Cc2d2a	A	G	5: 43,730,041	N1271S	probably benign	Het
Ccpg1	G	A	9: 73,013,044	S647N	probably benign	Het
Cdv3	T	C	9: 103,355,230	K133R	possibly damaging	Het
Cep128	A	C	12: 90,999,571	S1087R	probably benign	Het
Cep70	T	A	9: 99,281,075	L325Q	probably damaging	Het
Chit1	T	G	1: 134,149,454	F332V	probably damaging	Het
Chodl	C	A	16: 78,946,697	T219K	probably damaging	Het
Cntn4	T	C	6: 106,181,804	L10P	possibly damaging	Het
Copg1	G	T	6: 87,890,207	M87I	possibly damaging	Het
Cyp3a59	A	G	5: 146,085,768	Y28C	probably benign	Het
Dchs1	A	C	7: 105,758,029	V2119G	probably damaging	Het
Dedd	T	C	1: 171,338,383	L23P	probably damaging	Het
Dmxl2	A	G	9: 54,378,757	S2715P	probably benign	Het
Dnah9	T	C	11: 66,029,356	N2237S	probably damaging	Het
Drosha	A	G	15: 12,842,121	I337V	probably benign	Het
Duox2	A	G	2: 122,295,136	V330A	probably benign	Het
Dusp11	T	C	6: 85,947,605	*322W	probably null	Het
Dusp8	T	A	7: 142,089,993	Q61L	possibly damaging	Het
Ears2	G	C	7: 122,044,377	T426S	probably benign	Het
Elmo1	T	C	13: 20,600,210	Y646H	probably benign	Het
Eps15	T	A	4: 109,321,225	I220K	possibly damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam171a2	C	A	11: 102,437,867	V689L	possibly damaging	Het
Fam213b	T	A	4: 154,899,005	M1L	probably benign	Het
Fam91a1	G	A	15: 58,448,394	S645N	probably benign	Het
Fancg	G	A	4: 43,007,076	Q234*	probably null	Het
Gid4	T	A	11: 60,432,442		probably null	Het
Gm14085	C	A	2: 122,522,778	L480I	probably benign	Het
Gm7361	A	C	5: 26,258,905	T53P	probably benign	Het
Golgb1	T	A	16: 36,912,315	C641*	probably null	Het
Gon4l	T	A	3: 88,858,496	M409K	probably benign	Het
Gpatch8	A	T	11: 102,508,227		probably null	Het
Gpr156	T	A	16: 37,948,309	V64E	possibly damaging	Het
Grid2	T	A	6: 63,931,105	I243K	probably damaging	Het
Gucy2g	G	A	19: 55,215,116	A750V	probably damaging	Het
Hdac5	T	C	11: 102,202,141	E590G	possibly damaging	Het
Herc3	T	A	6: 58,874,278	M504K	probably damaging	Het
Hif1a	A	G	12: 73,944,093	E713G	probably benign	Het
Hmx3	A	G	7: 131,544,304	D247G	probably damaging	Het
Hoxd11	G	T	2: 74,682,819	E143*	probably null	Het
Ifitm3	T	C	7: 141,010,641	N2S	probably benign	Het
Il17f	T	C	1: 20,777,957	Q99R	probably benign	Het
Itga6	T	A	2: 71,841,150	S341R	probably damaging	Het
Itgam	A	G	7: 128,107,980	N661S	probably benign	Het
Jag1	A	T	2: 137,095,544	H303Q	possibly damaging	Het
Kcnh8	T	A	17: 52,725,995	N103K	probably benign	Het
Kdm6b	T	C	11: 69,400,810		probably benign	Het
Keg1	A	C	19: 12,714,538	N63T	probably damaging	Het
Klf12	T	A	14: 99,900,159	H317L	probably damaging	Het
Lrp1	A	T	10: 127,592,114	V530E	probably damaging	Het
Mrgpra6	A	G	7: 47,188,881	C190R	probably damaging	Het
Myo1a	G	T	10: 127,705,897	E102*	probably null	Het
Napa	A	T	7: 16,116,472	E265D	probably benign	Het
Ncam1	A	C	9: 49,564,874	V305G	probably damaging	Het
Nek8	T	C	11: 78,170,437		probably null	Het
Olfr1115	C	T	2: 87,252,483	P182L	probably benign	Het
Olfr1242	G	T	2: 89,494,137	Y58*	probably null	Het
Olfr1275	T	C	2: 111,231,194	T200A	probably benign	Het
Olfr191	T	A	16: 59,085,890	M198L	probably benign	Het
Olfr243	T	C	7: 103,717,355	F254L	probably benign	Het
Olfr251	A	T	9: 38,377,985	I29F	probably benign	Het
Olfr739	T	A	14: 50,425,389	V290E	possibly damaging	Het
Olfr971	A	G	9: 39,839,830	Y132C	possibly damaging	Het
Olfr987	T	C	2: 85,331,635	T88A	probably benign	Het
Pabpc4	A	G	4: 123,294,997	Q417R	probably benign	Het
Panx3	A	T	9: 37,669,024	M11K	probably damaging	Het
Pcbp1	C	T	6: 86,525,489	E143K	probably damaging	Het
Pdcd7	G	A	9: 65,358,692	W477*	probably null	Het
Pi4k2a	G	A	19: 42,090,515	S5N	probably damaging	Het
Plag1	T	A	4: 3,904,075	Q372L	probably benign	Het
Plce1	C	A	19: 38,760,091	N1755K	probably damaging	Het
Pld4	G	T	12: 112,763,988	E102*	probably null	Het
Pnlip	A	G	19: 58,679,607	N345S	probably benign	Het
Ppm1e	A	T	11: 87,358,551	L118Q	possibly damaging	Het
Prkra	T	G	2: 76,639,278	T146P	probably damaging	Het
Prpf8	A	G	11: 75,495,799	D1038G	probably damaging	Het
Prss51	T	A	14: 64,097,094	V108E	probably damaging	Het
Reln	A	G	5: 22,039,529	V817A	probably benign	Het
Rictor	C	A	15: 6,789,504	Q1403K	probably benign	Het
Rims1	T	A	1: 22,412,245	I882F	probably damaging	Het
Rnf19a	A	G	15: 36,242,039	V618A	probably benign	Het
Ryr1	A	T	7: 29,117,416	I65N	probably damaging	Het
S1pr2	T	C	9: 20,967,594	T313A	probably benign	Het
Serpine2	A	T	1: 79,821,287	Y83*	probably null	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Sgip1	T	C	4: 102,915,059	V215A	probably benign	Het
Sgsm3	T	C	15: 81,007,999	V256A	probably benign	Het
Shroom4	T	A	X: 6,585,469	C894*	probably null	Het
Slc14a2	T	A	18: 78,185,840	D306V	possibly damaging	Het
Slc4a10	A	T	2: 62,290,058	E843V	probably damaging	Het
Smyd4	T	A	11: 75,390,156	C152S	probably damaging	Het
Snx10	T	C	6: 51,575,972	Y32H	probably damaging	Het
Sorl1	T	C	9: 42,057,284	T558A	possibly damaging	Het
Spata31d1b	G	A	13: 59,719,052	C1338Y	possibly damaging	Het
Sppl2c	T	A	11: 104,187,301	I309K	possibly damaging	Het
Stard9	A	G	2: 120,700,630	E2456G	probably damaging	Het
Stx1b	A	T	7: 127,815,403	D16E	probably benign	Het
Tecpr2	T	C	12: 110,915,453	V152A	probably damaging	Het
Tedc1	T	C	12: 113,156,682	V47A	probably benign	Het
Tep1	A	T	14: 50,868,317	L82Q	probably damaging	Het
Tgm4	A	G	9: 123,056,494	Y367C	probably damaging	Het
Tle1	C	T	4: 72,141,844	V258M	probably damaging	Het
Tm9sf1	C	T	14: 55,642,844	G32D	possibly damaging	Het
Tmco2	A	G	4: 121,105,984	L106P	probably damaging	Het
Tmem131	A	T	1: 36,872,558	C103S	possibly damaging	Het
Tmprss7	T	A	16: 45,669,528	I444F	possibly damaging	Het
Trank1	T	C	9: 111,362,402	V493A	probably benign	Het
Trim80	A	T	11: 115,448,017	T558S	probably benign	Het
Trmt6	C	A	2: 132,808,783	A302S	probably benign	Het
Ttc17	A	T	2: 94,303,640	W1067R	probably damaging	Het
Tulp4	T	A	17: 6,236,293	V1532D	probably damaging	Het
Ubqlnl	T	G	7: 104,149,217	I358L	probably benign	Het
Ulk3	T	A	9: 57,590,740	I108N	possibly damaging	Het
Vps13b	A	T	15: 35,640,528		probably null	Het
Vwa3a	A	G	7: 120,790,142	K68E	possibly damaging	Het
Zfp746	G	T	6: 48,064,176	H538N	possibly damaging	Het

Other mutations in Ptch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Ptch1	APN	13	63527175	missense	probably benign	0.00
IGL01084:Ptch1	APN	13	63543637	missense	probably damaging	0.99
IGL01369:Ptch1	APN	13	63511681	missense	probably benign
IGL02260:Ptch1	APN	13	63565352	unclassified	probably benign
IGL02439:Ptch1	APN	13	63545096	missense	probably damaging	1.00
IGL02588:Ptch1	APN	13	63511918	missense	probably benign	0.13
IGL02797:Ptch1	APN	13	63533607	missense	probably benign
R0463:Ptch1	UTSW	13	63520307	missense	probably damaging	0.98
R0539:Ptch1	UTSW	13	63543480	splice site	probably benign
R0657:Ptch1	UTSW	13	63513751	missense	possibly damaging	0.90
R0971:Ptch1	UTSW	13	63539843	missense	probably benign	0.23
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1539:Ptch1	UTSW	13	63541287	missense	probably benign	0.00
R1616:Ptch1	UTSW	13	63539842	missense	possibly damaging	0.96
R1883:Ptch1	UTSW	13	63512027	nonsense	probably null
R1985:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R1986:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2024:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2025:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2026:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2027:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2096:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2097:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2100:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2105:Ptch1	UTSW	13	63545245	missense	probably benign
R2165:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2166:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2167:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2168:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2226:Ptch1	UTSW	13	63513671	missense	probably damaging	1.00
R2437:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2504:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2507:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2696:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63542224	missense	probably damaging	1.00
R2971:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3410:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3708:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3744:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3745:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3783:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3784:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3785:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3807:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3950:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4013:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4015:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4016:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4017:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4035:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4083:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4084:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4179:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4222:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4348:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4349:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4350:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4351:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4353:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4485:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4595:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R4625:Ptch1	UTSW	13	63523164	missense	probably benign	0.02
R4809:Ptch1	UTSW	13	63513708	missense	probably damaging	0.98
R4904:Ptch1	UTSW	13	63523004	missense	probably damaging	1.00
R4911:Ptch1	UTSW	13	63523052	missense	probably damaging	1.00
R4942:Ptch1	UTSW	13	63525070	missense	probably benign	0.02
R5447:Ptch1	UTSW	13	63527245	missense	probably benign
R5604:Ptch1	UTSW	13	63525122	missense	probably benign	0.01
R5846:Ptch1	UTSW	13	63565454	unclassified	probably benign
R5926:Ptch1	UTSW	13	63545055	missense	probably benign	0.01
R5945:Ptch1	UTSW	13	63573419	utr 5 prime	probably benign
R5957:Ptch1	UTSW	13	63525115	missense	probably damaging	1.00
R6326:Ptch1	UTSW	13	63543545	missense	probably damaging	1.00
R6358:Ptch1	UTSW	13	63513689	missense	probably damaging	0.96
R6376:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R6599:Ptch1	UTSW	13	63523104	missense	probably damaging	0.98
R6615:Ptch1	UTSW	13	63539830	missense	possibly damaging	0.46
R6965:Ptch1	UTSW	13	63525067	missense	possibly damaging	0.63
R7149:Ptch1	UTSW	13	63511736	missense	probably benign	0.23
R7168:Ptch1	UTSW	13	63512060	missense	probably benign
R7257:Ptch1	UTSW	13	63573294	missense	not run
R7258:Ptch1	UTSW	13	63573294	missense	not run
R7259:Ptch1	UTSW	13	63573294	missense	not run
R7368:Ptch1	UTSW	13	63511984	missense	probably benign	0.06
R7525:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7528:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7820:Ptch1	UTSW	13	63523061	missense	probably damaging	1.00
R8077:Ptch1	UTSW	13	63540812	missense	probably damaging	0.98
R8373:Ptch1	UTSW	13	63541168	missense	probably damaging	1.00
R8398:Ptch1	UTSW	13	63525125	missense	probably benign	0.06
R8407:Ptch1	UTSW	13	63514243	missense	probably null	1.00
R8839:Ptch1	UTSW	13	63541224	missense	probably damaging	1.00
R9075:Ptch1	UTSW	13	63533521	missense	possibly damaging	0.87
R9476:Ptch1	UTSW	13	63533634	missense	probably benign	0.05
R9514:Ptch1	UTSW	13	63527257	missense	probably benign
R9528:Ptch1	UTSW	13	63513801	missense	probably benign	0.00
R9568:Ptch1	UTSW	13	63542173	missense	probably damaging	0.99
Z1177:Ptch1	UTSW	13	63520279	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AACATTCTGCTGAAATCCCCTC -3'
(R):5'- CAGGGGAACTTATCACGGAGAC -3'

Sequencing Primer
(F):5'- ATGATAAGCCACACCGGA -3'
(R):5'- CTTATCACGGAGACAGGTTACATG -3'

Posted On

2016-08-04