Incidental Mutation 'R5386:Tep1'
ID425274
Institutional Source Beutler Lab
Gene Symbol Tep1
Ensembl Gene ENSMUSG00000006281
Gene Nametelomerase associated protein 1
SynonymsTp1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5386 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50824059-50870560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50868317 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 82 (L82Q)
Ref Sequence ENSEMBL: ENSMUSP00000006444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006444]
Predicted Effect probably damaging
Transcript: ENSMUST00000006444
AA Change: L82Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: L82Q

DomainStartEndE-ValueType
Pfam:TEP1_N 1 29 2.8e-20 PFAM
Pfam:TEP1_N 31 59 1.4e-20 PFAM
Pfam:TEP1_N 61 89 3.1e-20 PFAM
Pfam:TEP1_N 91 119 3e-20 PFAM
low complexity region 195 207 N/A INTRINSIC
low complexity region 211 229 N/A INTRINSIC
Pfam:TROVE 230 685 3.2e-136 PFAM
Pfam:DUF4062 909 1020 2.4e-22 PFAM
Pfam:NACHT 1171 1346 9.2e-38 PFAM
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1622 1641 N/A INTRINSIC
WD40 1673 1711 2.98e-1 SMART
WD40 1714 1752 5.33e0 SMART
WD40 1755 1794 1.52e-4 SMART
WD40 1797 1835 3.27e-4 SMART
WD40 1838 1877 3.09e-1 SMART
WD40 1880 1919 2.24e-2 SMART
WD40 1925 1962 4.95e0 SMART
WD40 1968 2003 2.29e1 SMART
WD40 2008 2045 1.72e0 SMART
WD40 2058 2097 3.89e-11 SMART
WD40 2103 2142 3.93e-7 SMART
WD40 2145 2182 4.38e-5 SMART
WD40 2184 2232 1.24e0 SMART
WD40 2235 2273 1.14e-3 SMART
WD40 2275 2315 4.46e-1 SMART
Blast:WD40 2316 2353 4e-12 BLAST
WD40 2546 2583 6.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228254
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,194,413 G887R probably damaging Het
4931406P16Rik A G 7: 34,242,388 F120L probably damaging Het
Abcc12 T G 8: 86,517,489 K1012Q possibly damaging Het
Afmid G A 11: 117,828,142 G33R probably benign Het
Agbl3 G T 6: 34,799,196 W207C probably damaging Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Ak2 T C 4: 129,008,172 S213P probably benign Het
Alk T A 17: 71,875,012 N1339Y probably damaging Het
Angpt1 T C 15: 42,438,365 S416G probably damaging Het
Ank2 C T 3: 126,981,933 V854M probably benign Het
Ankrd61 G T 5: 143,891,664 N122K possibly damaging Het
Armc9 T A 1: 86,198,289 L34Q probably null Het
Aspg T A 12: 112,123,032 V418E probably benign Het
Baz1b C T 5: 135,238,059 R1241C probably damaging Het
Bclaf1 T C 10: 20,325,592 V201A possibly damaging Het
C1ql3 A T 2: 13,004,358 D225E probably damaging Het
Capn9 A G 8: 124,605,540 T417A possibly damaging Het
Card14 C T 11: 119,317,289 R62C probably damaging Het
Cc2d2a A G 5: 43,730,041 N1271S probably benign Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cdv3 T C 9: 103,355,230 K133R possibly damaging Het
Cep128 A C 12: 90,999,571 S1087R probably benign Het
Cep70 T A 9: 99,281,075 L325Q probably damaging Het
Chit1 T G 1: 134,149,454 F332V probably damaging Het
Chodl C A 16: 78,946,697 T219K probably damaging Het
Cntn4 T C 6: 106,181,804 L10P possibly damaging Het
Copg1 G T 6: 87,890,207 M87I possibly damaging Het
Cyp3a59 A G 5: 146,085,768 Y28C probably benign Het
Dchs1 A C 7: 105,758,029 V2119G probably damaging Het
Dedd T C 1: 171,338,383 L23P probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnah9 T C 11: 66,029,356 N2237S probably damaging Het
Drosha A G 15: 12,842,121 I337V probably benign Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp11 T C 6: 85,947,605 *322W probably null Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Ears2 G C 7: 122,044,377 T426S probably benign Het
Elmo1 T C 13: 20,600,210 Y646H probably benign Het
Eps15 T A 4: 109,321,225 I220K possibly damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam171a2 C A 11: 102,437,867 V689L possibly damaging Het
Fam213b T A 4: 154,899,005 M1L probably benign Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fancg G A 4: 43,007,076 Q234* probably null Het
Gid4 T A 11: 60,432,442 probably null Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gm7361 A C 5: 26,258,905 T53P probably benign Het
Golgb1 T A 16: 36,912,315 C641* probably null Het
Gon4l T A 3: 88,858,496 M409K probably benign Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gpr156 T A 16: 37,948,309 V64E possibly damaging Het
Grid2 T A 6: 63,931,105 I243K probably damaging Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hdac5 T C 11: 102,202,141 E590G possibly damaging Het
Herc3 T A 6: 58,874,278 M504K probably damaging Het
Hif1a A G 12: 73,944,093 E713G probably benign Het
Hmx3 A G 7: 131,544,304 D247G probably damaging Het
Hoxd11 G T 2: 74,682,819 E143* probably null Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Il17f T C 1: 20,777,957 Q99R probably benign Het
Itga6 T A 2: 71,841,150 S341R probably damaging Het
Itgam A G 7: 128,107,980 N661S probably benign Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kcnh8 T A 17: 52,725,995 N103K probably benign Het
Kdm6b T C 11: 69,400,810 probably benign Het
Keg1 A C 19: 12,714,538 N63T probably damaging Het
Klf12 T A 14: 99,900,159 H317L probably damaging Het
Lrp1 A T 10: 127,592,114 V530E probably damaging Het
Mrgpra6 A G 7: 47,188,881 C190R probably damaging Het
Myo1a G T 10: 127,705,897 E102* probably null Het
Napa A T 7: 16,116,472 E265D probably benign Het
Ncam1 A C 9: 49,564,874 V305G probably damaging Het
Nek8 T C 11: 78,170,437 probably null Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1242 G T 2: 89,494,137 Y58* probably null Het
Olfr1275 T C 2: 111,231,194 T200A probably benign Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Olfr243 T C 7: 103,717,355 F254L probably benign Het
Olfr251 A T 9: 38,377,985 I29F probably benign Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Olfr971 A G 9: 39,839,830 Y132C possibly damaging Het
Olfr987 T C 2: 85,331,635 T88A probably benign Het
Pabpc4 A G 4: 123,294,997 Q417R probably benign Het
Panx3 A T 9: 37,669,024 M11K probably damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pi4k2a G A 19: 42,090,515 S5N probably damaging Het
Plag1 T A 4: 3,904,075 Q372L probably benign Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pld4 G T 12: 112,763,988 E102* probably null Het
Pnlip A G 19: 58,679,607 N345S probably benign Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Ptch1 A G 13: 63,545,043 Y181H probably damaging Het
Reln A G 5: 22,039,529 V817A probably benign Het
Rictor C A 15: 6,789,504 Q1403K probably benign Het
Rims1 T A 1: 22,412,245 I882F probably damaging Het
Rnf19a A G 15: 36,242,039 V618A probably benign Het
Ryr1 A T 7: 29,117,416 I65N probably damaging Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Serpine2 A T 1: 79,821,287 Y83* probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc14a2 T A 18: 78,185,840 D306V possibly damaging Het
Slc4a10 A T 2: 62,290,058 E843V probably damaging Het
Smyd4 T A 11: 75,390,156 C152S probably damaging Het
Snx10 T C 6: 51,575,972 Y32H probably damaging Het
Sorl1 T C 9: 42,057,284 T558A possibly damaging Het
Spata31d1b G A 13: 59,719,052 C1338Y possibly damaging Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Tecpr2 T C 12: 110,915,453 V152A probably damaging Het
Tedc1 T C 12: 113,156,682 V47A probably benign Het
Tgm4 A G 9: 123,056,494 Y367C probably damaging Het
Tle1 C T 4: 72,141,844 V258M probably damaging Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tmco2 A G 4: 121,105,984 L106P probably damaging Het
Tmem131 A T 1: 36,872,558 C103S possibly damaging Het
Tmprss7 T A 16: 45,669,528 I444F possibly damaging Het
Trank1 T C 9: 111,362,402 V493A probably benign Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Tulp4 T A 17: 6,236,293 V1532D probably damaging Het
Ubqlnl T G 7: 104,149,217 I358L probably benign Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vps13b A T 15: 35,640,528 probably null Het
Vwa3a A G 7: 120,790,142 K68E possibly damaging Het
Zfp746 G T 6: 48,064,176 H538N possibly damaging Het
Other mutations in Tep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tep1 APN 14 50843184 missense probably damaging 1.00
IGL00490:Tep1 APN 14 50833473 missense probably damaging 0.97
IGL01114:Tep1 APN 14 50850639 missense probably damaging 0.98
IGL01294:Tep1 APN 14 50829657 splice site probably benign
IGL01902:Tep1 APN 14 50866091 splice site probably benign
IGL01910:Tep1 APN 14 50844112 missense probably benign 0.06
IGL01925:Tep1 APN 14 50824498 unclassified probably benign
IGL01965:Tep1 APN 14 50863495 splice site probably benign
IGL02071:Tep1 APN 14 50834049 missense possibly damaging 0.93
IGL02124:Tep1 APN 14 50854124 unclassified probably benign
IGL02189:Tep1 APN 14 50826826 missense probably benign
IGL02252:Tep1 APN 14 50830255 missense possibly damaging 0.93
IGL02299:Tep1 APN 14 50840671 missense probably damaging 0.99
IGL02343:Tep1 APN 14 50829247 missense probably damaging 0.99
IGL02423:Tep1 APN 14 50844620 missense possibly damaging 0.53
IGL02537:Tep1 APN 14 50836113 missense probably damaging 0.96
IGL02601:Tep1 APN 14 50833478 nonsense probably null
IGL02941:Tep1 APN 14 50866037 missense probably damaging 0.98
IGL02990:Tep1 APN 14 50868246 missense possibly damaging 0.86
IGL03144:Tep1 APN 14 50844017 splice site probably benign
IGL03209:Tep1 APN 14 50840703 splice site probably benign
PIT4305001:Tep1 UTSW 14 50829227 missense possibly damaging 0.90
PIT4362001:Tep1 UTSW 14 50866053 missense probably benign 0.23
R0058:Tep1 UTSW 14 50834065 missense possibly damaging 0.85
R0060:Tep1 UTSW 14 50866029 missense probably damaging 1.00
R0109:Tep1 UTSW 14 50851916 splice site probably null
R0123:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0134:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0148:Tep1 UTSW 14 50824789 missense possibly damaging 0.70
R0240:Tep1 UTSW 14 50863029 splice site probably benign
R0243:Tep1 UTSW 14 50846987 missense probably damaging 1.00
R0373:Tep1 UTSW 14 50836768 missense possibly damaging 0.85
R0432:Tep1 UTSW 14 50866823 small deletion probably benign
R0464:Tep1 UTSW 14 50847684 missense probably benign 0.00
R0566:Tep1 UTSW 14 50845414 critical splice donor site probably null
R0691:Tep1 UTSW 14 50866844 nonsense probably null
R0787:Tep1 UTSW 14 50829230 missense possibly damaging 0.85
R0972:Tep1 UTSW 14 50824296 unclassified probably benign
R1263:Tep1 UTSW 14 50845513 missense possibly damaging 0.84
R1300:Tep1 UTSW 14 50827055 critical splice donor site probably null
R1327:Tep1 UTSW 14 50853099 missense probably benign 0.18
R1556:Tep1 UTSW 14 50853042 missense probably benign 0.06
R1584:Tep1 UTSW 14 50866037 missense probably damaging 0.98
R1607:Tep1 UTSW 14 50824563 missense probably null 0.99
R1686:Tep1 UTSW 14 50836788 missense probably benign 0.12
R1715:Tep1 UTSW 14 50854567 missense possibly damaging 0.92
R1778:Tep1 UTSW 14 50829622 intron probably benign
R1993:Tep1 UTSW 14 50824184 missense possibly damaging 0.93
R2071:Tep1 UTSW 14 50854282 missense probably benign 0.23
R2104:Tep1 UTSW 14 50850580 splice site probably benign
R2118:Tep1 UTSW 14 50855572 intron probably null
R2119:Tep1 UTSW 14 50838986 missense probably benign 0.13
R2208:Tep1 UTSW 14 50866864 missense probably benign 0.01
R2241:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2243:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2311:Tep1 UTSW 14 50833567 missense possibly damaging 0.95
R2420:Tep1 UTSW 14 50834023 missense probably benign
R2874:Tep1 UTSW 14 50850650 missense possibly damaging 0.71
R3084:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3086:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3621:Tep1 UTSW 14 50829020 missense probably damaging 0.99
R3815:Tep1 UTSW 14 50868315 missense possibly damaging 0.71
R4124:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4125:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4127:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4134:Tep1 UTSW 14 50844860 missense probably benign
R4152:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4153:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4191:Tep1 UTSW 14 50836806 missense probably damaging 0.96
R4248:Tep1 UTSW 14 50862894 missense possibly damaging 0.93
R4293:Tep1 UTSW 14 50846861 missense probably benign
R4569:Tep1 UTSW 14 50824740 missense probably benign 0.01
R4704:Tep1 UTSW 14 50837073 missense probably benign 0.06
R4815:Tep1 UTSW 14 50841302 missense probably damaging 0.99
R4978:Tep1 UTSW 14 50845434 missense possibly damaging 0.93
R4989:Tep1 UTSW 14 50839000 missense probably benign
R5022:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5057:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5063:Tep1 UTSW 14 50850627 missense possibly damaging 0.86
R5118:Tep1 UTSW 14 50855587 splice site probably null
R5128:Tep1 UTSW 14 50844279 makesense probably null
R5149:Tep1 UTSW 14 50837398 nonsense probably null
R5171:Tep1 UTSW 14 50824802 missense probably benign 0.01
R5201:Tep1 UTSW 14 50868110 missense probably benign 0.01
R5260:Tep1 UTSW 14 50838631 missense probably benign
R5339:Tep1 UTSW 14 50844574 missense probably damaging 0.99
R5384:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5385:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5594:Tep1 UTSW 14 50829882 missense possibly damaging 0.86
R5639:Tep1 UTSW 14 50853605 missense possibly damaging 0.85
R5749:Tep1 UTSW 14 50844072 missense possibly damaging 0.59
R5756:Tep1 UTSW 14 50837379 critical splice donor site probably null
R6013:Tep1 UTSW 14 50861048 missense probably damaging 0.97
R6014:Tep1 UTSW 14 50847000 missense probably benign 0.12
R6248:Tep1 UTSW 14 50830258 missense probably damaging 0.98
R6264:Tep1 UTSW 14 50845513 missense probably damaging 0.99
R6363:Tep1 UTSW 14 50824548 missense probably benign 0.04
R6381:Tep1 UTSW 14 50845431 missense probably damaging 0.99
R6462:Tep1 UTSW 14 50844379 missense probably benign
R6942:Tep1 UTSW 14 50836737 missense possibly damaging 0.85
R6951:Tep1 UTSW 14 50833913 critical splice donor site probably null
R6979:Tep1 UTSW 14 50838637 missense possibly damaging 0.93
R6999:Tep1 UTSW 14 50850705 missense possibly damaging 0.86
R7099:Tep1 UTSW 14 50844487 intron probably null
R7208:Tep1 UTSW 14 50824556 critical splice acceptor site probably null
R7232:Tep1 UTSW 14 50844332 missense unknown
R7249:Tep1 UTSW 14 50824275 missense possibly damaging 0.86
R7325:Tep1 UTSW 14 50866038 missense probably damaging 0.99
R7409:Tep1 UTSW 14 50866855 missense possibly damaging 0.67
R7499:Tep1 UTSW 14 50853590 missense probably damaging 0.99
R7542:Tep1 UTSW 14 50862491 nonsense probably null
R7806:Tep1 UTSW 14 50836809 missense possibly damaging 0.85
R7825:Tep1 UTSW 14 50843887 critical splice acceptor site probably null
RF007:Tep1 UTSW 14 50860945 missense possibly damaging 0.92
X0024:Tep1 UTSW 14 50827119 missense possibly damaging 0.86
X0060:Tep1 UTSW 14 50836764 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GATCAGCTTGTGCCGTATGAG -3'
(R):5'- ATGTGCCTGGCCATTCAGAC -3'

Sequencing Primer
(F):5'- CCGTATGAGATATGTGAAGACCCTG -3'
(R):5'- TCTCCTTGAAGAACCGGTGC -3'
Posted On2016-08-04