Mutagenetix > Incidental Mutations

Incidental Mutation 'R5387:Nrp2'

425304

Institutional Source

Beutler Lab

Gene Symbol

Nrp2

Ensembl Gene

ENSMUSG00000025969

Gene Name

neuropilin 2

Synonyms

Npn2, NP-2, NP2, Npn-2, 1110048P06Rik

MMRRC Submission

042959-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.945) question?

Stock #

R5387 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62703285-62818695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62762813 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 472 (S472P)

Ref Sequence

ENSEMBL: ENSMUSP00000099886 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027112] [ENSMUST00000063594] [ENSMUST00000075144] [ENSMUST00000102822] [ENSMUST00000114155] [ENSMUST00000114157]

Predicted Effect

probably benign
Transcript: ENSMUST00000027112
AA Change: S472P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000027112
Gene: ENSMUSG00000025969
AA Change: S472P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
Pfam:DUF3481	822	906	1.4e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000063594
AA Change: S472P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000069379
Gene: ENSMUSG00000025969
AA Change: S472P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
low complexity region	816	831	N/A	INTRINSIC
Pfam:DUF3481	839	923	1.6e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000075144
AA Change: S472P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000074642
Gene: ENSMUSG00000025969
AA Change: S472P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
Pfam:DUF3481	827	911	2.3e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102822
AA Change: S472P

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000099886
Gene: ENSMUSG00000025969
AA Change: S472P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
Pfam:DUF3481	822	906	2.3e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114155
AA Change: S472P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000109792
Gene: ENSMUSG00000025969
AA Change: S472P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
Pfam:DUF3481	817	901	9.4e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114157
AA Change: S472P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000109794
Gene: ENSMUSG00000025969
AA Change: S472P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
low complexity region	821	836	N/A	INTRINSIC
Pfam:DUF3481	844	928	2.4e-25	PFAM

Meta Mutation Damage Score

0.2709

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice may exhibit pre- or postnatal lethality, reduced fertility, hydrocephalus, aberrant sensory innervation, reduced interneuron count, seizure susceptibility and abnormal lymphangiogenesis. Homozygotes for a gene trap allele show abnormal neuronal development and axonal trajectories. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	A	T	11: 51,685,974	D32E	probably benign	Het
2210408I21Rik	T	A	13: 77,259,973	S140T	probably benign	Het
Ahnak	T	C	19: 9,003,691	S780P	probably damaging	Het
Ankhd1	C	A	18: 36,634,644	H1205N	probably damaging	Het
Ano1	T	C	7: 144,648,619	K139R	probably benign	Het
Anp32b	T	G	4: 46,468,573	C114W	probably damaging	Het
Ascl1	C	T	10: 87,492,689	A134T	probably damaging	Het
Atl2	C	T	17: 79,852,800	E453K	probably benign	Het
Aup1	C	T	6: 83,055,024	A84V	probably damaging	Het
Btbd7	A	T	12: 102,837,785	M332K	probably damaging	Het
Cacna1d	A	G	14: 30,100,751	V1107A	probably damaging	Het
Cd33	G	A	7: 43,532,053	Q114*	probably null	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Defb22	C	A	2: 152,485,906	A120S	unknown	Het
Dnah7b	A	G	1: 46,188,659	I1347M	probably damaging	Het
Efcab5	A	G	11: 77,134,842	I549T	possibly damaging	Het
Esp15	T	A	17: 39,644,577		probably null	Het
Fbxo7	A	G	10: 86,024,654	T42A	probably benign	Het
Filip1	A	G	9: 79,818,274	I1021T	probably benign	Het
Gad1	C	A	2: 70,563,851	S7*	probably null	Het
Gm281	C	A	14: 13,914,438	M1I	probably null	Het
H2-Q7	C	T	17: 35,439,542	T52M	probably damaging	Het
H2-T3	C	T	17: 36,186,702	G28R	probably benign	Het
Hist1h2ad	T	A	13: 23,574,667		probably null	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ift81	A	G	5: 122,555,535	Y604H	probably damaging	Het
Igsf11	A	G	16: 39,022,423	Y154C	probably damaging	Het
Kif26b	G	T	1: 178,914,876	A846S	probably benign	Het
Lnx2	G	A	5: 147,028,154	P420S	probably benign	Het
Lrit2	A	G	14: 37,072,259	T427A	probably damaging	Het
Lrrc43	G	T	5: 123,499,671		probably null	Het
Mug1	T	C	6: 121,884,394	Y1325H	probably damaging	Het
Naglu	A	T	11: 101,076,724	Y500F	probably damaging	Het
Npy4r	A	G	14: 34,146,983	M116T	probably benign	Het
Nrd1	A	G	4: 109,039,762	Y526C	probably damaging	Het
Olfr102	T	A	17: 37,314,292	T31S	probably benign	Het
Olfr361	T	C	2: 37,085,719	T10A	possibly damaging	Het
Otogl	T	A	10: 107,780,933	T1828S	probably benign	Het
Pank2	C	T	2: 131,274,262	T200I	probably benign	Het
Pbrm1	A	G	14: 31,082,610	Y946C	probably damaging	Het
Pde12	A	T	14: 26,666,453	S437T	probably benign	Het
Pikfyve	A	G	1: 65,265,268	K1710E	possibly damaging	Het
Plcd3	A	G	11: 103,078,455	S229P	probably damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Prkaa2	C	A	4: 105,040,177	D280Y	probably damaging	Het
Ptprg	T	A	14: 12,153,873	S531R	probably damaging	Het
R3hdm2	T	C	10: 127,485,434	S620P	probably damaging	Het
Rab33b	A	G	3: 51,493,455	T117A	probably damaging	Het
Rasal2	T	C	1: 157,157,765	D804G	possibly damaging	Het
Rbp3	A	G	14: 33,956,413	T773A	possibly damaging	Het
Rrnad1	A	T	3: 87,930,011		probably benign	Het
Rspry1	A	G	8: 94,638,286	T185A	possibly damaging	Het
Sec61a2	G	T	2: 5,882,545		probably benign	Het
Setx	C	T	2: 29,147,594	R1364C	probably benign	Het
Shtn1	G	T	19: 59,038,369	L97M	probably damaging	Het
Slc35f1	T	C	10: 53,108,164	L340P	probably damaging	Het
Slc45a1	T	A	4: 150,643,909		probably benign	Het
Slmap	T	C	14: 26,459,933	E386G	probably benign	Het
Smc2	C	T	4: 52,475,096	A924V	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Tecta	G	A	9: 42,375,063	L766F	probably damaging	Het
Tle3	C	T	9: 61,407,489		probably null	Het
Top3a	A	G	11: 60,762,490	F53L	probably damaging	Het
Trem1	T	C	17: 48,241,513	I26T	possibly damaging	Het
Ttc7b	G	T	12: 100,446,963	Q199K	possibly damaging	Het
Ubap2l	T	C	3: 90,006,596	Y975C	probably benign	Het
Ubxn11	C	A	4: 134,123,426	D196E	probably damaging	Het
Unc80	A	G	1: 66,530,021	H945R	possibly damaging	Het
Usp15	A	G	10: 123,131,286	I405T	probably damaging	Het
Uty	C	T	Y: 1,189,339	E138K	probably damaging	Het
Wapl	A	G	14: 34,677,295	E107G	probably benign	Het
Wbp1l	T	C	19: 46,644,457		probably null	Het
Zfp184	T	G	13: 21,949,640		probably benign	Het
Zfp36	A	C	7: 28,377,868	L205R	possibly damaging	Het

Other mutations in Nrp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00765:Nrp2	APN	1	62704251	nonsense	probably null
IGL01912:Nrp2	APN	1	62771737	missense	probably damaging	1.00
IGL01996:Nrp2	APN	1	62749260	missense	probably damaging	1.00
IGL02184:Nrp2	APN	1	62718940	nonsense	probably null
IGL02682:Nrp2	APN	1	62771837	missense	probably benign	0.03
IGL02928:Nrp2	APN	1	62815446	missense	probably damaging	1.00
IGL03024:Nrp2	APN	1	62771734	missense	probably damaging	1.00
R0068:Nrp2	UTSW	1	62745377	missense	possibly damaging	0.95
R0068:Nrp2	UTSW	1	62745377	missense	possibly damaging	0.95
R0683:Nrp2	UTSW	1	62744318	missense	probably benign	0.41
R0789:Nrp2	UTSW	1	62745450	missense	probably benign	0.44
R1418:Nrp2	UTSW	1	62783332	nonsense	probably null
R1468:Nrp2	UTSW	1	62738299	missense	probably damaging	1.00
R1468:Nrp2	UTSW	1	62738299	missense	probably damaging	1.00
R1544:Nrp2	UTSW	1	62762904	missense	probably damaging	1.00
R1645:Nrp2	UTSW	1	62785124	missense	probably damaging	0.97
R1677:Nrp2	UTSW	1	62783320	missense	probably benign	0.18
R1752:Nrp2	UTSW	1	62738441	missense	probably damaging	1.00
R1840:Nrp2	UTSW	1	62738339	missense	probably damaging	1.00
R1916:Nrp2	UTSW	1	62762747	missense	probably damaging	1.00
R1962:Nrp2	UTSW	1	62718931	missense	probably benign	0.03
R2108:Nrp2	UTSW	1	62744277	missense	probably damaging	1.00
R2164:Nrp2	UTSW	1	62744355	missense	probably damaging	1.00
R2216:Nrp2	UTSW	1	62762918	nonsense	probably null
R2679:Nrp2	UTSW	1	62785078	missense	probably benign	0.00
R4349:Nrp2	UTSW	1	62738417	missense	probably damaging	1.00
R4351:Nrp2	UTSW	1	62738417	missense	probably damaging	1.00
R4352:Nrp2	UTSW	1	62738417	missense	probably damaging	1.00
R4353:Nrp2	UTSW	1	62738417	missense	probably damaging	1.00
R4811:Nrp2	UTSW	1	62719081	missense	probably damaging	1.00
R5362:Nrp2	UTSW	1	62769062	missense	probably benign	0.01
R5461:Nrp2	UTSW	1	62747211	nonsense	probably null
R5704:Nrp2	UTSW	1	62785108	missense	probably benign	0.00
R6143:Nrp2	UTSW	1	62760815	missense	probably damaging	1.00
R6303:Nrp2	UTSW	1	62745406	missense	probably damaging	1.00
R6304:Nrp2	UTSW	1	62745406	missense	probably damaging	1.00
R6376:Nrp2	UTSW	1	62719017	missense	possibly damaging	0.65
R6945:Nrp2	UTSW	1	62760788	missense	probably damaging	1.00
R7347:Nrp2	UTSW	1	62745504	missense	probably benign	0.04
R7393:Nrp2	UTSW	1	62745424	missense	probably damaging	0.98
R7593:Nrp2	UTSW	1	62719044	missense	probably damaging	0.96
R7881:Nrp2	UTSW	1	62771831	missense	probably benign	0.42
R7882:Nrp2	UTSW	1	62783521	missense	probably damaging	1.00
R7948:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R7964:Nrp2	UTSW	1	62771831	missense	probably benign	0.42
R7965:Nrp2	UTSW	1	62783521	missense	probably damaging	1.00
R8009:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8012:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8014:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8015:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8068:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8069:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8070:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8071:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAGCATGTGACCTGACGGC -3'
(R):5'- CCATTTAGGCTGTAGGAGACTTTG -3'

Sequencing Primer
(F):5'- GTGGACTCCAATTAGTAGGTCTCAGC -3'
(R):5'- AGGAGACTTTGAACTTGCGTAC -3'

Posted On

2016-08-04