Incidental Mutation 'R5387:Col4a4'
ID 425307
Institutional Source Beutler Lab
Gene Symbol Col4a4
Ensembl Gene ENSMUSG00000067158
Gene Name collagen, type IV, alpha 4
Synonyms E130010M05Rik, [a]4(IV)
MMRRC Submission 042959-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R5387 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 82426144-82564570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 82471312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 681 (G681E)
Ref Sequence ENSEMBL: ENSMUSP00000084282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087050]
AlphaFold Q9QZR9
Predicted Effect unknown
Transcript: ENSMUST00000087050
AA Change: G681E
SMART Domains Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158
AA Change: G681E

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
Pfam:Collagen 54 113 4e-11 PFAM
Pfam:Collagen 110 168 4.1e-10 PFAM
Pfam:Collagen 172 229 2.8e-10 PFAM
low complexity region 265 288 N/A INTRINSIC
internal_repeat_7 289 345 1.46e-9 PROSPERO
internal_repeat_6 291 348 5.03e-10 PROSPERO
internal_repeat_9 297 353 7.22e-9 PROSPERO
internal_repeat_4 322 354 2.06e-11 PROSPERO
internal_repeat_11 334 349 1.25e-5 PROSPERO
Pfam:Collagen 392 449 1.3e-8 PFAM
low complexity region 461 482 N/A INTRINSIC
Pfam:Collagen 486 553 1e-10 PFAM
low complexity region 563 595 N/A INTRINSIC
Pfam:Collagen 597 658 1e-8 PFAM
Pfam:Collagen 663 731 4.4e-10 PFAM
Pfam:Collagen 755 810 3.3e-9 PFAM
internal_repeat_2 816 841 2.9e-13 PROSPERO
Pfam:Collagen 844 912 1.8e-10 PFAM
Pfam:Collagen 898 962 2.7e-10 PFAM
low complexity region 963 1003 N/A INTRINSIC
Pfam:Collagen 1006 1071 2e-10 PFAM
Pfam:Collagen 1073 1132 5.8e-12 PFAM
Pfam:Collagen 1124 1185 1.8e-10 PFAM
Pfam:Collagen 1187 1245 2.3e-8 PFAM
low complexity region 1277 1361 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
Pfam:Collagen 1395 1454 4.3e-8 PFAM
C4 1457 1564 3.36e-58 SMART
C4 1565 1681 1.49e-59 SMART
Meta Mutation Damage Score 0.9291 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,408,092 (GRCm39) S140T probably benign Het
Ahnak T C 19: 8,981,055 (GRCm39) S780P probably damaging Het
Ankhd1 C A 18: 36,767,697 (GRCm39) H1205N probably damaging Het
Ano1 T C 7: 144,202,356 (GRCm39) K139R probably benign Het
Anp32b T G 4: 46,468,573 (GRCm39) C114W probably damaging Het
Ascl1 C T 10: 87,328,551 (GRCm39) A134T probably damaging Het
Atl2 C T 17: 80,160,229 (GRCm39) E453K probably benign Het
Aup1 C T 6: 83,032,005 (GRCm39) A84V probably damaging Het
Btbd7 A T 12: 102,804,044 (GRCm39) M332K probably damaging Het
Cacna1d A G 14: 29,822,708 (GRCm39) V1107A probably damaging Het
Cd33 G A 7: 43,181,477 (GRCm39) Q114* probably null Het
Cdhr18 C A 14: 13,914,438 (GRCm38) M1I probably null Het
Defb22 C A 2: 152,327,826 (GRCm39) A120S unknown Het
Dnah7b A G 1: 46,227,819 (GRCm39) I1347M probably damaging Het
Efcab5 A G 11: 77,025,668 (GRCm39) I549T possibly damaging Het
Esp15 T A 17: 39,955,468 (GRCm39) probably null Het
Fbxo7 A G 10: 85,860,518 (GRCm39) T42A probably benign Het
Filip1 A G 9: 79,725,556 (GRCm39) I1021T probably benign Het
Gad1 C A 2: 70,394,195 (GRCm39) S7* probably null Het
H2ac7 T A 13: 23,758,841 (GRCm39) probably null Het
H2-Q7 C T 17: 35,658,518 (GRCm39) T52M probably damaging Het
H2-T3 C T 17: 36,497,594 (GRCm39) G28R probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Ift81 A G 5: 122,693,598 (GRCm39) Y604H probably damaging Het
Igsf11 A G 16: 38,842,785 (GRCm39) Y154C probably damaging Het
Kif26b G T 1: 178,742,441 (GRCm39) A846S probably benign Het
Lnx2 G A 5: 146,964,964 (GRCm39) P420S probably benign Het
Lrit2 A G 14: 36,794,216 (GRCm39) T427A probably damaging Het
Lrrc43 G T 5: 123,637,734 (GRCm39) probably null Het
Mettl25b A T 3: 87,837,318 (GRCm39) probably benign Het
Mug1 T C 6: 121,861,353 (GRCm39) Y1325H probably damaging Het
Naglu A T 11: 100,967,550 (GRCm39) Y500F probably damaging Het
Npy4r A G 14: 33,868,940 (GRCm39) M116T probably benign Het
Nrdc A G 4: 108,896,959 (GRCm39) Y526C probably damaging Het
Nrp2 T C 1: 62,801,972 (GRCm39) S472P probably benign Het
Or12d2 T A 17: 37,625,183 (GRCm39) T31S probably benign Het
Or12k8 T C 2: 36,975,731 (GRCm39) T10A possibly damaging Het
Otogl T A 10: 107,616,794 (GRCm39) T1828S probably benign Het
Pank2 C T 2: 131,116,182 (GRCm39) T200I probably benign Het
Pbrm1 A G 14: 30,804,567 (GRCm39) Y946C probably damaging Het
Pde12 A T 14: 26,387,608 (GRCm39) S437T probably benign Het
Pikfyve A G 1: 65,304,427 (GRCm39) K1710E possibly damaging Het
Plcd3 A G 11: 102,969,281 (GRCm39) S229P probably damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Prkaa2 C A 4: 104,897,374 (GRCm39) D280Y probably damaging Het
Ptprg T A 14: 12,153,873 (GRCm38) S531R probably damaging Het
R3hdm2 T C 10: 127,321,303 (GRCm39) S620P probably damaging Het
Rab33b A G 3: 51,400,876 (GRCm39) T117A probably damaging Het
Rasal2 T C 1: 156,985,335 (GRCm39) D804G possibly damaging Het
Rbp3 A G 14: 33,678,370 (GRCm39) T773A possibly damaging Het
Rspry1 A G 8: 95,364,914 (GRCm39) T185A possibly damaging Het
Sec61a2 G T 2: 5,887,356 (GRCm39) probably benign Het
Setx C T 2: 29,037,606 (GRCm39) R1364C probably benign Het
Shtn1 G T 19: 59,026,801 (GRCm39) L97M probably damaging Het
Slc35f1 T C 10: 52,984,260 (GRCm39) L340P probably damaging Het
Slc45a1 T A 4: 150,728,366 (GRCm39) probably benign Het
Slmap T C 14: 26,181,088 (GRCm39) E386G probably benign Het
Smc2 C T 4: 52,475,096 (GRCm39) A924V probably benign Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Tecta G A 9: 42,286,359 (GRCm39) L766F probably damaging Het
Tle3 C T 9: 61,314,771 (GRCm39) probably null Het
Top3a A G 11: 60,653,316 (GRCm39) F53L probably damaging Het
Trappc2b A T 11: 51,576,801 (GRCm39) D32E probably benign Het
Trem1 T C 17: 48,548,541 (GRCm39) I26T possibly damaging Het
Ttc7b G T 12: 100,413,222 (GRCm39) Q199K possibly damaging Het
Ubap2l T C 3: 89,913,903 (GRCm39) Y975C probably benign Het
Ubxn11 C A 4: 133,850,737 (GRCm39) D196E probably damaging Het
Unc80 A G 1: 66,569,180 (GRCm39) H945R possibly damaging Het
Usp15 A G 10: 122,967,191 (GRCm39) I405T probably damaging Het
Uty C T Y: 1,189,339 (GRCm39) E138K probably damaging Het
Wapl A G 14: 34,399,252 (GRCm39) E107G probably benign Het
Wbp1l T C 19: 46,632,896 (GRCm39) probably null Het
Zfp184 T G 13: 22,133,810 (GRCm39) probably benign Het
Zfp36 A C 7: 28,077,293 (GRCm39) L205R possibly damaging Het
Other mutations in Col4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col4a4 APN 1 82,469,362 (GRCm39) missense unknown
IGL01092:Col4a4 APN 1 82,444,266 (GRCm39) missense unknown
IGL01104:Col4a4 APN 1 82,444,266 (GRCm39) missense unknown
IGL01413:Col4a4 APN 1 82,448,969 (GRCm39) missense unknown
IGL01518:Col4a4 APN 1 82,433,480 (GRCm39) missense unknown
IGL02014:Col4a4 APN 1 82,501,681 (GRCm39) splice site probably benign
IGL02215:Col4a4 APN 1 82,431,530 (GRCm39) missense unknown
IGL02707:Col4a4 APN 1 82,471,237 (GRCm39) missense unknown
IGL02858:Col4a4 APN 1 82,506,204 (GRCm39) missense unknown
IGL02987:Col4a4 APN 1 82,476,646 (GRCm39) splice site probably benign
IGL03384:Col4a4 APN 1 82,462,159 (GRCm39) missense probably benign 0.04
amazement UTSW 1 82,458,207 (GRCm39) nonsense probably null
aoba UTSW 1 82,513,461 (GRCm39) critical splice donor site probably benign
asombro UTSW 1 82,466,730 (GRCm39) critical splice donor site probably null
astonishment UTSW 1 82,433,449 (GRCm39) missense unknown
wonderment UTSW 1 82,430,865 (GRCm39) missense unknown
IGL02980:Col4a4 UTSW 1 82,447,198 (GRCm39) critical splice donor site probably null
R0028:Col4a4 UTSW 1 82,465,231 (GRCm39) critical splice donor site probably null
R0083:Col4a4 UTSW 1 82,484,832 (GRCm39) critical splice acceptor site probably null
R0696:Col4a4 UTSW 1 82,470,270 (GRCm39) missense unknown
R0788:Col4a4 UTSW 1 82,502,717 (GRCm39) missense unknown
R0789:Col4a4 UTSW 1 82,502,717 (GRCm39) missense unknown
R0790:Col4a4 UTSW 1 82,502,717 (GRCm39) missense unknown
R0894:Col4a4 UTSW 1 82,507,377 (GRCm39) splice site probably null
R1217:Col4a4 UTSW 1 82,466,730 (GRCm39) critical splice donor site probably null
R1465:Col4a4 UTSW 1 82,475,543 (GRCm39) splice site probably null
R1465:Col4a4 UTSW 1 82,475,543 (GRCm39) splice site probably null
R1474:Col4a4 UTSW 1 82,458,207 (GRCm39) nonsense probably null
R1508:Col4a4 UTSW 1 82,433,557 (GRCm39) missense unknown
R1640:Col4a4 UTSW 1 82,513,491 (GRCm39) missense unknown
R1678:Col4a4 UTSW 1 82,464,380 (GRCm39) missense unknown
R1827:Col4a4 UTSW 1 82,517,709 (GRCm39) missense unknown
R1930:Col4a4 UTSW 1 82,444,321 (GRCm39) splice site probably null
R1931:Col4a4 UTSW 1 82,444,321 (GRCm39) splice site probably null
R2092:Col4a4 UTSW 1 82,476,667 (GRCm39) missense unknown
R2122:Col4a4 UTSW 1 82,434,592 (GRCm39) missense unknown
R2132:Col4a4 UTSW 1 82,475,581 (GRCm39) missense unknown
R2396:Col4a4 UTSW 1 82,484,793 (GRCm39) missense unknown
R2418:Col4a4 UTSW 1 82,510,657 (GRCm39) missense unknown
R2679:Col4a4 UTSW 1 82,507,332 (GRCm39) missense unknown
R3085:Col4a4 UTSW 1 82,507,285 (GRCm39) critical splice donor site probably null
R3437:Col4a4 UTSW 1 82,474,889 (GRCm39) missense unknown
R3697:Col4a4 UTSW 1 82,518,958 (GRCm39) missense unknown
R3730:Col4a4 UTSW 1 82,433,472 (GRCm39) splice site probably null
R3752:Col4a4 UTSW 1 82,458,215 (GRCm39) missense probably damaging 0.97
R4085:Col4a4 UTSW 1 82,448,909 (GRCm39) critical splice donor site probably null
R4087:Col4a4 UTSW 1 82,501,643 (GRCm39) missense unknown
R4088:Col4a4 UTSW 1 82,501,643 (GRCm39) missense unknown
R4090:Col4a4 UTSW 1 82,501,643 (GRCm39) missense unknown
R4213:Col4a4 UTSW 1 82,430,865 (GRCm39) missense unknown
R4422:Col4a4 UTSW 1 82,467,559 (GRCm39) missense unknown
R4596:Col4a4 UTSW 1 82,448,940 (GRCm39) missense unknown
R4755:Col4a4 UTSW 1 82,518,895 (GRCm39) missense unknown
R4757:Col4a4 UTSW 1 82,506,187 (GRCm39) missense unknown
R4793:Col4a4 UTSW 1 82,516,820 (GRCm39) missense unknown
R4812:Col4a4 UTSW 1 82,439,874 (GRCm39) missense unknown
R4833:Col4a4 UTSW 1 82,507,323 (GRCm39) missense unknown
R5259:Col4a4 UTSW 1 82,431,614 (GRCm39) missense unknown
R5264:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5265:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5281:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5283:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5284:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5388:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5435:Col4a4 UTSW 1 82,431,728 (GRCm39) missense unknown
R5534:Col4a4 UTSW 1 82,465,238 (GRCm39) missense unknown
R5666:Col4a4 UTSW 1 82,463,300 (GRCm39) critical splice donor site probably null
R5670:Col4a4 UTSW 1 82,463,300 (GRCm39) critical splice donor site probably null
R5943:Col4a4 UTSW 1 82,502,737 (GRCm39) missense unknown
R5996:Col4a4 UTSW 1 82,433,449 (GRCm39) missense unknown
R5999:Col4a4 UTSW 1 82,470,340 (GRCm39) missense unknown
R6112:Col4a4 UTSW 1 82,431,604 (GRCm39) missense unknown
R6192:Col4a4 UTSW 1 82,462,151 (GRCm39) missense probably damaging 1.00
R6237:Col4a4 UTSW 1 82,484,752 (GRCm39) missense unknown
R6419:Col4a4 UTSW 1 82,444,207 (GRCm39) critical splice donor site probably null
R6458:Col4a4 UTSW 1 82,433,546 (GRCm39) missense unknown
R6460:Col4a4 UTSW 1 82,444,253 (GRCm39) missense unknown
R6481:Col4a4 UTSW 1 82,431,499 (GRCm39) missense unknown
R6522:Col4a4 UTSW 1 82,465,304 (GRCm39) missense unknown
R7000:Col4a4 UTSW 1 82,475,051 (GRCm39) missense unknown
R7015:Col4a4 UTSW 1 82,484,671 (GRCm39) missense unknown
R7055:Col4a4 UTSW 1 82,496,757 (GRCm39) missense unknown
R7288:Col4a4 UTSW 1 82,470,184 (GRCm39) missense unknown
R7293:Col4a4 UTSW 1 82,501,664 (GRCm39) missense unknown
R7300:Col4a4 UTSW 1 82,464,361 (GRCm39) missense unknown
R7458:Col4a4 UTSW 1 82,476,669 (GRCm39) missense unknown
R7520:Col4a4 UTSW 1 82,484,808 (GRCm39) nonsense probably null
R7727:Col4a4 UTSW 1 82,506,514 (GRCm39) missense unknown
R7803:Col4a4 UTSW 1 82,467,419 (GRCm39) critical splice donor site probably null
R7953:Col4a4 UTSW 1 82,431,689 (GRCm39) missense unknown
R7959:Col4a4 UTSW 1 82,484,780 (GRCm39) missense unknown
R7982:Col4a4 UTSW 1 82,549,162 (GRCm39) start gained probably benign
R8000:Col4a4 UTSW 1 82,519,018 (GRCm39) missense unknown
R8057:Col4a4 UTSW 1 82,501,591 (GRCm39) missense unknown
R8126:Col4a4 UTSW 1 82,431,007 (GRCm39) missense unknown
R8406:Col4a4 UTSW 1 82,501,611 (GRCm39) missense unknown
R8699:Col4a4 UTSW 1 82,433,455 (GRCm39) missense unknown
R8835:Col4a4 UTSW 1 82,447,313 (GRCm39) missense unknown
R8916:Col4a4 UTSW 1 82,501,667 (GRCm39) missense unknown
R8921:Col4a4 UTSW 1 82,431,533 (GRCm39) missense unknown
R8990:Col4a4 UTSW 1 82,473,555 (GRCm39) missense unknown
R9002:Col4a4 UTSW 1 82,449,032 (GRCm39) missense probably benign 0.26
R9116:Col4a4 UTSW 1 82,431,752 (GRCm39) missense unknown
R9176:Col4a4 UTSW 1 82,463,349 (GRCm39) missense unknown
R9211:Col4a4 UTSW 1 82,506,501 (GRCm39) missense unknown
R9246:Col4a4 UTSW 1 82,430,956 (GRCm39) missense unknown
R9463:Col4a4 UTSW 1 82,431,076 (GRCm39) missense unknown
R9666:Col4a4 UTSW 1 82,496,670 (GRCm39) missense unknown
R9686:Col4a4 UTSW 1 82,474,962 (GRCm39) missense unknown
R9705:Col4a4 UTSW 1 82,465,313 (GRCm39) missense unknown
R9749:Col4a4 UTSW 1 82,463,353 (GRCm39) missense unknown
R9774:Col4a4 UTSW 1 82,484,665 (GRCm39) critical splice donor site probably null
X0020:Col4a4 UTSW 1 82,517,673 (GRCm39) critical splice donor site probably null
Z1088:Col4a4 UTSW 1 82,430,917 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATAGCTGAGGGTCTGTGTCC -3'
(R):5'- ACCACACTGGAAAACTTTTGG -3'

Sequencing Primer
(F):5'- AGGGTCTGTGTCCCCCAAC -3'
(R):5'- CCATGAAGGGATGCTGCTTAC -3'
Posted On 2016-08-04