Mutagenetix > Incidental Mutation

Incidental Mutation 'R5387:Kif26b'

425308

Institutional Source

Beutler Lab

Gene Symbol

Kif26b

Ensembl Gene

ENSMUSG00000026494

Gene Name

kinesin family member 26B

Synonyms

D230039L06Rik, N-11 kinesin

MMRRC Submission

042959-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5387 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

178529125-178939200 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 178914876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 846 (A846S)

Ref Sequence

ENSEMBL: ENSMUSP00000124462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160789] [ENSMUST00000161017]

AlphaFold

Q7TNC6

Predicted Effect

probably benign
Transcript: ENSMUST00000160789
AA Change: A399S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000124608
Gene: ENSMUSG00000026494
AA Change: A399S

Domain	Start	End	E-Value	Type
KISc	1	362	2.48e-42	SMART
low complexity region	363	375	N/A	INTRINSIC
low complexity region	402	416	N/A	INTRINSIC
low complexity region	460	466	N/A	INTRINSIC
low complexity region	560	600	N/A	INTRINSIC
low complexity region	652	662	N/A	INTRINSIC
low complexity region	822	841	N/A	INTRINSIC
low complexity region	1038	1048	N/A	INTRINSIC
low complexity region	1294	1322	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161017
AA Change: A846S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: A846S

Domain	Start	End	E-Value	Type
low complexity region	58	123	N/A	INTRINSIC
low complexity region	144	155	N/A	INTRINSIC
low complexity region	220	228	N/A	INTRINSIC
Blast:KISc	365	446	4e-8	BLAST
KISc	448	809	2.48e-42	SMART
low complexity region	810	822	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	907	913	N/A	INTRINSIC
low complexity region	1007	1047	N/A	INTRINSIC
low complexity region	1099	1109	N/A	INTRINSIC
low complexity region	1269	1288	N/A	INTRINSIC
low complexity region	1485	1495	N/A	INTRINSIC
low complexity region	1741	1769	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162545

Meta Mutation Damage Score

0.0836

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (80/81)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	A	T	11: 51,685,974	D32E	probably benign	Het
2210408I21Rik	T	A	13: 77,259,973	S140T	probably benign	Het
Ahnak	T	C	19: 9,003,691	S780P	probably damaging	Het
Ankhd1	C	A	18: 36,634,644	H1205N	probably damaging	Het
Ano1	T	C	7: 144,648,619	K139R	probably benign	Het
Anp32b	T	G	4: 46,468,573	C114W	probably damaging	Het
Ascl1	C	T	10: 87,492,689	A134T	probably damaging	Het
Atl2	C	T	17: 79,852,800	E453K	probably benign	Het
Aup1	C	T	6: 83,055,024	A84V	probably damaging	Het
Btbd7	A	T	12: 102,837,785	M332K	probably damaging	Het
Cacna1d	A	G	14: 30,100,751	V1107A	probably damaging	Het
Cd33	G	A	7: 43,532,053	Q114*	probably null	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Defb22	C	A	2: 152,485,906	A120S	unknown	Het
Dnah7b	A	G	1: 46,188,659	I1347M	probably damaging	Het
Efcab5	A	G	11: 77,134,842	I549T	possibly damaging	Het
Esp15	T	A	17: 39,644,577		probably null	Het
Fbxo7	A	G	10: 86,024,654	T42A	probably benign	Het
Filip1	A	G	9: 79,818,274	I1021T	probably benign	Het
Gad1	C	A	2: 70,563,851	S7*	probably null	Het
Gm281	C	A	14: 13,914,438	M1I	probably null	Het
H2-Q7	C	T	17: 35,439,542	T52M	probably damaging	Het
H2-T3	C	T	17: 36,186,702	G28R	probably benign	Het
Hist1h2ad	T	A	13: 23,574,667		probably null	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ift81	A	G	5: 122,555,535	Y604H	probably damaging	Het
Igsf11	A	G	16: 39,022,423	Y154C	probably damaging	Het
Lnx2	G	A	5: 147,028,154	P420S	probably benign	Het
Lrit2	A	G	14: 37,072,259	T427A	probably damaging	Het
Lrrc43	G	T	5: 123,499,671		probably null	Het
Mug1	T	C	6: 121,884,394	Y1325H	probably damaging	Het
Naglu	A	T	11: 101,076,724	Y500F	probably damaging	Het
Npy4r	A	G	14: 34,146,983	M116T	probably benign	Het
Nrd1	A	G	4: 109,039,762	Y526C	probably damaging	Het
Nrp2	T	C	1: 62,762,813	S472P	probably benign	Het
Olfr102	T	A	17: 37,314,292	T31S	probably benign	Het
Olfr361	T	C	2: 37,085,719	T10A	possibly damaging	Het
Otogl	T	A	10: 107,780,933	T1828S	probably benign	Het
Pank2	C	T	2: 131,274,262	T200I	probably benign	Het
Pbrm1	A	G	14: 31,082,610	Y946C	probably damaging	Het
Pde12	A	T	14: 26,666,453	S437T	probably benign	Het
Pikfyve	A	G	1: 65,265,268	K1710E	possibly damaging	Het
Plcd3	A	G	11: 103,078,455	S229P	probably damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Prkaa2	C	A	4: 105,040,177	D280Y	probably damaging	Het
Ptprg	T	A	14: 12,153,873	S531R	probably damaging	Het
R3hdm2	T	C	10: 127,485,434	S620P	probably damaging	Het
Rab33b	A	G	3: 51,493,455	T117A	probably damaging	Het
Rasal2	T	C	1: 157,157,765	D804G	possibly damaging	Het
Rbp3	A	G	14: 33,956,413	T773A	possibly damaging	Het
Rrnad1	A	T	3: 87,930,011		probably benign	Het
Rspry1	A	G	8: 94,638,286	T185A	possibly damaging	Het
Sec61a2	G	T	2: 5,882,545		probably benign	Het
Setx	C	T	2: 29,147,594	R1364C	probably benign	Het
Shtn1	G	T	19: 59,038,369	L97M	probably damaging	Het
Slc35f1	T	C	10: 53,108,164	L340P	probably damaging	Het
Slc45a1	T	A	4: 150,643,909		probably benign	Het
Slmap	T	C	14: 26,459,933	E386G	probably benign	Het
Smc2	C	T	4: 52,475,096	A924V	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Tecta	G	A	9: 42,375,063	L766F	probably damaging	Het
Tle3	C	T	9: 61,407,489		probably null	Het
Top3a	A	G	11: 60,762,490	F53L	probably damaging	Het
Trem1	T	C	17: 48,241,513	I26T	possibly damaging	Het
Ttc7b	G	T	12: 100,446,963	Q199K	possibly damaging	Het
Ubap2l	T	C	3: 90,006,596	Y975C	probably benign	Het
Ubxn11	C	A	4: 134,123,426	D196E	probably damaging	Het
Unc80	A	G	1: 66,530,021	H945R	possibly damaging	Het
Usp15	A	G	10: 123,131,286	I405T	probably damaging	Het
Uty	C	T	Y: 1,189,339	E138K	probably damaging	Het
Wapl	A	G	14: 34,677,295	E107G	probably benign	Het
Wbp1l	T	C	19: 46,644,457		probably null	Het
Zfp184	T	G	13: 21,949,640		probably benign	Het
Zfp36	A	C	7: 28,377,868	L205R	possibly damaging	Het

Other mutations in Kif26b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Kif26b	APN	1	178915648	missense	probably damaging	1.00
IGL00425:Kif26b	APN	1	178916301	missense	probably damaging	0.96
IGL00952:Kif26b	APN	1	178932205	missense	probably damaging	1.00
IGL01100:Kif26b	APN	1	178917244	missense	probably benign
IGL01347:Kif26b	APN	1	178870675	missense	probably damaging	1.00
IGL01543:Kif26b	APN	1	178678961	missense	probably benign	0.41
IGL01938:Kif26b	APN	1	178916038	missense	probably damaging	0.99
IGL02100:Kif26b	APN	1	178915947	missense	probably damaging	0.99
IGL02262:Kif26b	APN	1	178916068	missense	probably benign	0.05
IGL02576:Kif26b	APN	1	178916347	missense	probably benign
IGL02673:Kif26b	APN	1	178821605	missense	probably damaging	1.00
IGL03078:Kif26b	APN	1	178870726	missense	probably damaging	1.00
IGL03155:Kif26b	APN	1	178874128	missense	probably damaging	1.00
IGL03157:Kif26b	APN	1	178916365	missense	probably damaging	1.00
IGL03162:Kif26b	APN	1	178916932	missense	probably benign
IGL03220:Kif26b	APN	1	178864869	missense	probably damaging	1.00
IGL03299:Kif26b	APN	1	178821560	missense	probably benign	0.09
IGL03368:Kif26b	APN	1	178916208	missense	probably damaging	1.00
IGL03370:Kif26b	APN	1	178915381	missense	probably benign	0.39
PIT4449001:Kif26b	UTSW	1	178918086	missense	probably damaging	1.00
R0142:Kif26b	UTSW	1	178915389	missense	probably damaging	1.00
R0621:Kif26b	UTSW	1	178915653	missense	probably benign	0.02
R0987:Kif26b	UTSW	1	178821620	missense	probably damaging	1.00
R1107:Kif26b	UTSW	1	178917673	missense	probably benign	0.03
R1367:Kif26b	UTSW	1	178916463	missense	probably damaging	1.00
R1386:Kif26b	UTSW	1	178915644	missense	probably benign
R1619:Kif26b	UTSW	1	178916478	missense	probably benign	0.00
R1664:Kif26b	UTSW	1	178932139	missense	probably damaging	1.00
R2240:Kif26b	UTSW	1	178715923	missense	probably benign	0.00
R2264:Kif26b	UTSW	1	178928842	critical splice acceptor site	probably null
R2443:Kif26b	UTSW	1	178915014	missense	probably damaging	0.99
R3023:Kif26b	UTSW	1	178864868	missense	probably damaging	0.99
R3744:Kif26b	UTSW	1	178679030	missense	probably benign	0.00
R3831:Kif26b	UTSW	1	178916616	frame shift	probably null
R3832:Kif26b	UTSW	1	178916616	frame shift	probably null
R3833:Kif26b	UTSW	1	178916616	frame shift	probably null
R3843:Kif26b	UTSW	1	178928177	missense	probably damaging	1.00
R4108:Kif26b	UTSW	1	178916965	missense	possibly damaging	0.88
R4181:Kif26b	UTSW	1	178915426	missense	probably damaging	0.98
R4551:Kif26b	UTSW	1	178884035	missense	probably damaging	1.00
R4552:Kif26b	UTSW	1	178884035	missense	probably damaging	1.00
R4597:Kif26b	UTSW	1	178916793	missense	probably damaging	1.00
R4599:Kif26b	UTSW	1	178530459	missense	unknown
R4610:Kif26b	UTSW	1	178679355	missense	probably damaging	1.00
R4746:Kif26b	UTSW	1	178873981	nonsense	probably null
R4873:Kif26b	UTSW	1	178915327	missense	probably benign	0.38
R4875:Kif26b	UTSW	1	178915327	missense	probably benign	0.38
R5015:Kif26b	UTSW	1	178928330	missense	probably damaging	0.99
R5060:Kif26b	UTSW	1	178530630	missense	unknown
R5301:Kif26b	UTSW	1	178530668	missense	unknown
R5368:Kif26b	UTSW	1	178915884	missense	probably damaging	1.00
R5589:Kif26b	UTSW	1	178916299	missense	probably benign	0.05
R6150:Kif26b	UTSW	1	178915546	missense	probably damaging	1.00
R6259:Kif26b	UTSW	1	178917405	missense	probably damaging	0.97
R6355:Kif26b	UTSW	1	178916178	missense	probably damaging	1.00
R6408:Kif26b	UTSW	1	178917568	missense	probably damaging	1.00
R6488:Kif26b	UTSW	1	178529573	missense	unknown
R6546:Kif26b	UTSW	1	178928306	missense	probably damaging	1.00
R6702:Kif26b	UTSW	1	178917287	missense	possibly damaging	0.90
R6886:Kif26b	UTSW	1	178874138	missense	probably damaging	1.00
R6953:Kif26b	UTSW	1	178874072	missense	possibly damaging	0.89
R7262:Kif26b	UTSW	1	178917654	missense	possibly damaging	0.84
R7291:Kif26b	UTSW	1	178679046	missense	possibly damaging	0.86
R7346:Kif26b	UTSW	1	178530741	missense	probably damaging	1.00
R7383:Kif26b	UTSW	1	178530710	missense	probably damaging	1.00
R7448:Kif26b	UTSW	1	178914774	missense	probably damaging	1.00
R7506:Kif26b	UTSW	1	178529499	start gained	probably benign
R7562:Kif26b	UTSW	1	178914976	missense	probably damaging	1.00
R7583:Kif26b	UTSW	1	178530445	nonsense	probably null
R7585:Kif26b	UTSW	1	178916496	missense	probably benign	0.01
R7644:Kif26b	UTSW	1	178679274	missense	probably benign	0.04
R7759:Kif26b	UTSW	1	178678944	missense	probably damaging	1.00
R7775:Kif26b	UTSW	1	178864876	missense	probably benign	0.15
R7954:Kif26b	UTSW	1	178869379	missense	probably damaging	0.99
R7960:Kif26b	UTSW	1	178678919	missense	probably damaging	1.00
R8012:Kif26b	UTSW	1	178916250	missense	probably benign	0.20
R8152:Kif26b	UTSW	1	178679229	missense	possibly damaging	0.46
R8320:Kif26b	UTSW	1	178884076	critical splice donor site	probably null
R8360:Kif26b	UTSW	1	178916373	missense	probably benign	0.18
R8428:Kif26b	UTSW	1	178917358	missense	probably benign	0.09
R8670:Kif26b	UTSW	1	178913784	missense	probably damaging	1.00
R8737:Kif26b	UTSW	1	178864865	missense	probably damaging	0.99
R8788:Kif26b	UTSW	1	178529525	start gained	probably benign
R8854:Kif26b	UTSW	1	178916383	missense	possibly damaging	0.93
R8870:Kif26b	UTSW	1	178865029	missense	probably damaging	1.00
R8963:Kif26b	UTSW	1	178916149	missense	probably benign	0.00
R9232:Kif26b	UTSW	1	178914946	missense	probably damaging	1.00
R9297:Kif26b	UTSW	1	178715809	nonsense	probably null
R9338:Kif26b	UTSW	1	178916493	missense	probably damaging	1.00
R9572:Kif26b	UTSW	1	178917477	missense	probably benign
R9580:Kif26b	UTSW	1	178679078	nonsense	probably null
R9694:Kif26b	UTSW	1	178916250	missense	probably benign	0.20
X0021:Kif26b	UTSW	1	178928159	missense	probably damaging	1.00
X0024:Kif26b	UTSW	1	178679082	missense	probably benign	0.14
X0025:Kif26b	UTSW	1	178915266	nonsense	probably null
X0025:Kif26b	UTSW	1	178915383	missense	possibly damaging	0.70
Z1177:Kif26b	UTSW	1	178821548	missense	probably benign	0.11
Z1177:Kif26b	UTSW	1	178821550	nonsense	probably null
Z1177:Kif26b	UTSW	1	178915405	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGCAGGCTGGTCTTCAAG -3'
(R):5'- TCACCTCTGGTCTTCTGTAGGG -3'

Sequencing Primer
(F):5'- TGCAGTATGACACAGGCTTC -3'
(R):5'- CTGTAGGGCTGGCACAATG -3'

Posted On

2016-08-04