Incidental Mutation 'R5387:Rab33b'
ID425315
Institutional Source Beutler Lab
Gene Symbol Rab33b
Ensembl Gene ENSMUSG00000027739
Gene NameRAB33B, member RAS oncogene family
Synonyms
MMRRC Submission 042959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R5387 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location51483920-51496232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51493455 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 117 (T117A)
Ref Sequence ENSEMBL: ENSMUSP00000063054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054387]
PDB Structure
GppNHp-Bound Rab33 GTPase [X-RAY DIFFRACTION]
Crystal Structure of Gyp1 TBC domain in complex with Rab33 GTPase bound to GDP and AlF3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000054387
AA Change: T117A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063054
Gene: ENSMUSG00000027739
AA Change: T117A

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
RAB 34 202 1.94e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195715
Meta Mutation Damage Score 0.7276 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small GTP-binding protein of the Rab GTPase family, whose members function in vesicle transport during protein secretion and endocytosis. Rab GTPases are active, membrane-associated proteins that recruit effector proteins in the GTP-bound state and inactive cytosolic proteins when in a GDP-bound state. The protein encoded by this gene is ubiquitously expressed and has been implicated in Golgi to endoplasmic reticulum cycling of Golgi enzymes. In addition, this protein regulates Golgi homeostasis and coordinates intra-Golgi retrograde trafficking. Allelic variants in this gene have been associated with Dyggve-Melchior-Clausen syndrome and Smith-McCort dysplasia 2, which are autosomal recessive spondyloepimetaphyseal dysplasias characterized by skeletal abnormalities. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,685,974 D32E probably benign Het
2210408I21Rik T A 13: 77,259,973 S140T probably benign Het
Ahnak T C 19: 9,003,691 S780P probably damaging Het
Ankhd1 C A 18: 36,634,644 H1205N probably damaging Het
Ano1 T C 7: 144,648,619 K139R probably benign Het
Anp32b T G 4: 46,468,573 C114W probably damaging Het
Ascl1 C T 10: 87,492,689 A134T probably damaging Het
Atl2 C T 17: 79,852,800 E453K probably benign Het
Aup1 C T 6: 83,055,024 A84V probably damaging Het
Btbd7 A T 12: 102,837,785 M332K probably damaging Het
Cacna1d A G 14: 30,100,751 V1107A probably damaging Het
Cd33 G A 7: 43,532,053 Q114* probably null Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Defb22 C A 2: 152,485,906 A120S unknown Het
Dnah7b A G 1: 46,188,659 I1347M probably damaging Het
Efcab5 A G 11: 77,134,842 I549T possibly damaging Het
Esp15 T A 17: 39,644,577 probably null Het
Fbxo7 A G 10: 86,024,654 T42A probably benign Het
Filip1 A G 9: 79,818,274 I1021T probably benign Het
Gad1 C A 2: 70,563,851 S7* probably null Het
Gm281 C A 14: 13,914,438 M1I probably null Het
H2-Q7 C T 17: 35,439,542 T52M probably damaging Het
H2-T3 C T 17: 36,186,702 G28R probably benign Het
Hist1h2ad T A 13: 23,574,667 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift81 A G 5: 122,555,535 Y604H probably damaging Het
Igsf11 A G 16: 39,022,423 Y154C probably damaging Het
Kif26b G T 1: 178,914,876 A846S probably benign Het
Lnx2 G A 5: 147,028,154 P420S probably benign Het
Lrit2 A G 14: 37,072,259 T427A probably damaging Het
Lrrc43 G T 5: 123,499,671 probably null Het
Mug1 T C 6: 121,884,394 Y1325H probably damaging Het
Naglu A T 11: 101,076,724 Y500F probably damaging Het
Npy4r A G 14: 34,146,983 M116T probably benign Het
Nrd1 A G 4: 109,039,762 Y526C probably damaging Het
Nrp2 T C 1: 62,762,813 S472P probably benign Het
Olfr102 T A 17: 37,314,292 T31S probably benign Het
Olfr361 T C 2: 37,085,719 T10A possibly damaging Het
Otogl T A 10: 107,780,933 T1828S probably benign Het
Pank2 C T 2: 131,274,262 T200I probably benign Het
Pbrm1 A G 14: 31,082,610 Y946C probably damaging Het
Pde12 A T 14: 26,666,453 S437T probably benign Het
Pikfyve A G 1: 65,265,268 K1710E possibly damaging Het
Plcd3 A G 11: 103,078,455 S229P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkaa2 C A 4: 105,040,177 D280Y probably damaging Het
Ptprg T A 14: 12,153,873 S531R probably damaging Het
R3hdm2 T C 10: 127,485,434 S620P probably damaging Het
Rasal2 T C 1: 157,157,765 D804G possibly damaging Het
Rbp3 A G 14: 33,956,413 T773A possibly damaging Het
Rrnad1 A T 3: 87,930,011 probably benign Het
Rspry1 A G 8: 94,638,286 T185A possibly damaging Het
Sec61a2 G T 2: 5,882,545 probably benign Het
Setx C T 2: 29,147,594 R1364C probably benign Het
Shtn1 G T 19: 59,038,369 L97M probably damaging Het
Slc35f1 T C 10: 53,108,164 L340P probably damaging Het
Slc45a1 T A 4: 150,643,909 probably benign Het
Slmap T C 14: 26,459,933 E386G probably benign Het
Smc2 C T 4: 52,475,096 A924V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Tecta G A 9: 42,375,063 L766F probably damaging Het
Tle3 C T 9: 61,407,489 probably null Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Trem1 T C 17: 48,241,513 I26T possibly damaging Het
Ttc7b G T 12: 100,446,963 Q199K possibly damaging Het
Ubap2l T C 3: 90,006,596 Y975C probably benign Het
Ubxn11 C A 4: 134,123,426 D196E probably damaging Het
Unc80 A G 1: 66,530,021 H945R possibly damaging Het
Usp15 A G 10: 123,131,286 I405T probably damaging Het
Uty C T Y: 1,189,339 E138K probably damaging Het
Wapl A G 14: 34,677,295 E107G probably benign Het
Wbp1l T C 19: 46,644,457 probably null Het
Zfp184 T G 13: 21,949,640 probably benign Het
Zfp36 A C 7: 28,377,868 L205R possibly damaging Het
Other mutations in Rab33b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02756:Rab33b APN 3 51484524 missense probably damaging 1.00
R0012:Rab33b UTSW 3 51484316 start gained probably benign
R0690:Rab33b UTSW 3 51493417 missense probably damaging 1.00
R1027:Rab33b UTSW 3 51484455 missense probably damaging 1.00
R3151:Rab33b UTSW 3 51493648 missense possibly damaging 0.83
R5259:Rab33b UTSW 3 51484612 unclassified probably benign
R5650:Rab33b UTSW 3 51493416 missense probably damaging 1.00
R5997:Rab33b UTSW 3 51484479 missense possibly damaging 0.80
R6318:Rab33b UTSW 3 51493405 missense probably damaging 0.99
R6640:Rab33b UTSW 3 51484479 missense possibly damaging 0.80
Z1177:Rab33b UTSW 3 51484334 start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- ATTATGAAGCGTGGACCCTGC -3'
(R):5'- GGTCTCAAACAAAGGCATACTG -3'

Sequencing Primer
(F):5'- CCCTGCAGGTAAAGACGG -3'
(R):5'- GCATACTGTGTGTGTCAGCAAAC -3'
Posted On2016-08-04