Incidental Mutation 'R5387:Mettl25b'
ID 425316
Institutional Source Beutler Lab
Gene Symbol Mettl25b
Ensembl Gene ENSMUSG00000004896
Gene Name methyltransferase like 25B
Synonyms BC023814, Rrnad1
MMRRC Submission 042959-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R5387 (G1)
Quality Score 138
Status Validated
Chromosome 3
Chromosomal Location 87829908-87838024 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to T at 87837318 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005016] [ENSMUST00000055984] [ENSMUST00000160074] [ENSMUST00000160648] [ENSMUST00000164439] [ENSMUST00000160143]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005016
SMART Domains Protein: ENSMUSP00000005016
Gene: ENSMUSG00000004896

DomainStartEndE-ValueType
Pfam:Methyltransf_32 133 293 1.5e-29 PFAM
low complexity region 385 402 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055984
SMART Domains Protein: ENSMUSP00000059783
Gene: ENSMUSG00000048039

DomainStartEndE-ValueType
low complexity region 128 145 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
EXOIII 193 359 3.34e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160068
Predicted Effect probably benign
Transcript: ENSMUST00000160074
SMART Domains Protein: ENSMUSP00000125365
Gene: ENSMUSG00000004896

DomainStartEndE-ValueType
Pfam:Methyltransf_32 69 229 1.3e-29 PFAM
low complexity region 321 338 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161471
Predicted Effect probably benign
Transcript: ENSMUST00000160648
Predicted Effect probably benign
Transcript: ENSMUST00000164439
Predicted Effect probably benign
Transcript: ENSMUST00000160143
SMART Domains Protein: ENSMUSP00000124113
Gene: ENSMUSG00000004896

DomainStartEndE-ValueType
Pfam:Methyltransf_32 133 247 5e-15 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,408,092 (GRCm39) S140T probably benign Het
Ahnak T C 19: 8,981,055 (GRCm39) S780P probably damaging Het
Ankhd1 C A 18: 36,767,697 (GRCm39) H1205N probably damaging Het
Ano1 T C 7: 144,202,356 (GRCm39) K139R probably benign Het
Anp32b T G 4: 46,468,573 (GRCm39) C114W probably damaging Het
Ascl1 C T 10: 87,328,551 (GRCm39) A134T probably damaging Het
Atl2 C T 17: 80,160,229 (GRCm39) E453K probably benign Het
Aup1 C T 6: 83,032,005 (GRCm39) A84V probably damaging Het
Btbd7 A T 12: 102,804,044 (GRCm39) M332K probably damaging Het
Cacna1d A G 14: 29,822,708 (GRCm39) V1107A probably damaging Het
Cd33 G A 7: 43,181,477 (GRCm39) Q114* probably null Het
Cdhr18 C A 14: 13,914,438 (GRCm38) M1I probably null Het
Col4a4 C T 1: 82,471,312 (GRCm39) G681E unknown Het
Defb22 C A 2: 152,327,826 (GRCm39) A120S unknown Het
Dnah7b A G 1: 46,227,819 (GRCm39) I1347M probably damaging Het
Efcab5 A G 11: 77,025,668 (GRCm39) I549T possibly damaging Het
Esp15 T A 17: 39,955,468 (GRCm39) probably null Het
Fbxo7 A G 10: 85,860,518 (GRCm39) T42A probably benign Het
Filip1 A G 9: 79,725,556 (GRCm39) I1021T probably benign Het
Gad1 C A 2: 70,394,195 (GRCm39) S7* probably null Het
H2ac7 T A 13: 23,758,841 (GRCm39) probably null Het
H2-Q7 C T 17: 35,658,518 (GRCm39) T52M probably damaging Het
H2-T3 C T 17: 36,497,594 (GRCm39) G28R probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Ift81 A G 5: 122,693,598 (GRCm39) Y604H probably damaging Het
Igsf11 A G 16: 38,842,785 (GRCm39) Y154C probably damaging Het
Kif26b G T 1: 178,742,441 (GRCm39) A846S probably benign Het
Lnx2 G A 5: 146,964,964 (GRCm39) P420S probably benign Het
Lrit2 A G 14: 36,794,216 (GRCm39) T427A probably damaging Het
Lrrc43 G T 5: 123,637,734 (GRCm39) probably null Het
Mug1 T C 6: 121,861,353 (GRCm39) Y1325H probably damaging Het
Naglu A T 11: 100,967,550 (GRCm39) Y500F probably damaging Het
Npy4r A G 14: 33,868,940 (GRCm39) M116T probably benign Het
Nrdc A G 4: 108,896,959 (GRCm39) Y526C probably damaging Het
Nrp2 T C 1: 62,801,972 (GRCm39) S472P probably benign Het
Or12d2 T A 17: 37,625,183 (GRCm39) T31S probably benign Het
Or12k8 T C 2: 36,975,731 (GRCm39) T10A possibly damaging Het
Otogl T A 10: 107,616,794 (GRCm39) T1828S probably benign Het
Pank2 C T 2: 131,116,182 (GRCm39) T200I probably benign Het
Pbrm1 A G 14: 30,804,567 (GRCm39) Y946C probably damaging Het
Pde12 A T 14: 26,387,608 (GRCm39) S437T probably benign Het
Pikfyve A G 1: 65,304,427 (GRCm39) K1710E possibly damaging Het
Plcd3 A G 11: 102,969,281 (GRCm39) S229P probably damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Prkaa2 C A 4: 104,897,374 (GRCm39) D280Y probably damaging Het
Ptprg T A 14: 12,153,873 (GRCm38) S531R probably damaging Het
R3hdm2 T C 10: 127,321,303 (GRCm39) S620P probably damaging Het
Rab33b A G 3: 51,400,876 (GRCm39) T117A probably damaging Het
Rasal2 T C 1: 156,985,335 (GRCm39) D804G possibly damaging Het
Rbp3 A G 14: 33,678,370 (GRCm39) T773A possibly damaging Het
Rspry1 A G 8: 95,364,914 (GRCm39) T185A possibly damaging Het
Sec61a2 G T 2: 5,887,356 (GRCm39) probably benign Het
Setx C T 2: 29,037,606 (GRCm39) R1364C probably benign Het
Shtn1 G T 19: 59,026,801 (GRCm39) L97M probably damaging Het
Slc35f1 T C 10: 52,984,260 (GRCm39) L340P probably damaging Het
Slc45a1 T A 4: 150,728,366 (GRCm39) probably benign Het
Slmap T C 14: 26,181,088 (GRCm39) E386G probably benign Het
Smc2 C T 4: 52,475,096 (GRCm39) A924V probably benign Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Tecta G A 9: 42,286,359 (GRCm39) L766F probably damaging Het
Tle3 C T 9: 61,314,771 (GRCm39) probably null Het
Top3a A G 11: 60,653,316 (GRCm39) F53L probably damaging Het
Trappc2b A T 11: 51,576,801 (GRCm39) D32E probably benign Het
Trem1 T C 17: 48,548,541 (GRCm39) I26T possibly damaging Het
Ttc7b G T 12: 100,413,222 (GRCm39) Q199K possibly damaging Het
Ubap2l T C 3: 89,913,903 (GRCm39) Y975C probably benign Het
Ubxn11 C A 4: 133,850,737 (GRCm39) D196E probably damaging Het
Unc80 A G 1: 66,569,180 (GRCm39) H945R possibly damaging Het
Usp15 A G 10: 122,967,191 (GRCm39) I405T probably damaging Het
Uty C T Y: 1,189,339 (GRCm39) E138K probably damaging Het
Wapl A G 14: 34,399,252 (GRCm39) E107G probably benign Het
Wbp1l T C 19: 46,632,896 (GRCm39) probably null Het
Zfp184 T G 13: 22,133,810 (GRCm39) probably benign Het
Zfp36 A C 7: 28,077,293 (GRCm39) L205R possibly damaging Het
Other mutations in Mettl25b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1775:Mettl25b UTSW 3 87,831,124 (GRCm39) missense probably damaging 0.99
R2165:Mettl25b UTSW 3 87,834,360 (GRCm39) critical splice donor site probably null
R2307:Mettl25b UTSW 3 87,834,162 (GRCm39) missense possibly damaging 0.88
R3957:Mettl25b UTSW 3 87,834,135 (GRCm39) missense possibly damaging 0.82
R4651:Mettl25b UTSW 3 87,834,979 (GRCm39) missense probably benign
R4663:Mettl25b UTSW 3 87,835,055 (GRCm39) missense probably damaging 1.00
R4818:Mettl25b UTSW 3 87,832,305 (GRCm39) missense probably benign 0.32
R5427:Mettl25b UTSW 3 87,831,639 (GRCm39) unclassified probably benign
R7032:Mettl25b UTSW 3 87,831,649 (GRCm39) critical splice donor site probably null
R7048:Mettl25b UTSW 3 87,837,167 (GRCm39) missense probably damaging 1.00
R7953:Mettl25b UTSW 3 87,834,955 (GRCm39) missense possibly damaging 0.82
R8334:Mettl25b UTSW 3 87,835,056 (GRCm39) missense possibly damaging 0.46
R8969:Mettl25b UTSW 3 87,837,282 (GRCm39) intron probably benign
R9110:Mettl25b UTSW 3 87,834,978 (GRCm39) missense probably benign 0.03
R9142:Mettl25b UTSW 3 87,831,195 (GRCm39) missense probably benign 0.03
R9181:Mettl25b UTSW 3 87,835,392 (GRCm39) intron probably benign
R9257:Mettl25b UTSW 3 87,831,768 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGAAGAGATAAAAGCTGTCTCCAC -3'
(R):5'- CAGTGGAAGTCGTGACGTTG -3'

Sequencing Primer
(F):5'- GCAGTGGGCTCCTATTCAC -3'
(R):5'- AGTCGTGACGTTGGGCAAG -3'
Posted On 2016-08-04