Mutagenetix > Incidental Mutations

Incidental Mutation 'R5387:Prkaa2'

425320

Institutional Source

Beutler Lab

Gene Symbol

Prkaa2

Ensembl Gene

ENSMUSG00000028518

Gene Name

protein kinase, AMP-activated, alpha 2 catalytic subunit

Synonyms

2310008I11Rik, AMPKalpha2

MMRRC Submission

042959-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5387 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105029874-105109890 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 105040177 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 280 (D280Y)

Ref Sequence

ENSEMBL: ENSMUSP00000030243 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030243]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030243
AA Change: D280Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030243
Gene: ENSMUSG00000028518
AA Change: D280Y

Domain	Start	End	E-Value	Type
S_TKc	16	268	1.47e-103	SMART
Pfam:AdenylateSensor	401	501	6.4e-18	PFAM
low complexity region	511	527	N/A	INTRINSIC

Meta Mutation Damage Score

0.1679

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a catalytic subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. Studies of the mouse counterpart suggest that this catalytic subunit may control whole-body insulin sensitivity and is necessary for maintaining myocardial energy homeostasis during ischemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are hyperglycemic, hypoinsulinemic, and show glucose intolerance and insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	A	T	11: 51,685,974	D32E	probably benign	Het
2210408I21Rik	T	A	13: 77,259,973	S140T	probably benign	Het
Ahnak	T	C	19: 9,003,691	S780P	probably damaging	Het
Ankhd1	C	A	18: 36,634,644	H1205N	probably damaging	Het
Ano1	T	C	7: 144,648,619	K139R	probably benign	Het
Anp32b	T	G	4: 46,468,573	C114W	probably damaging	Het
Ascl1	C	T	10: 87,492,689	A134T	probably damaging	Het
Atl2	C	T	17: 79,852,800	E453K	probably benign	Het
Aup1	C	T	6: 83,055,024	A84V	probably damaging	Het
Btbd7	A	T	12: 102,837,785	M332K	probably damaging	Het
Cacna1d	A	G	14: 30,100,751	V1107A	probably damaging	Het
Cd33	G	A	7: 43,532,053	Q114*	probably null	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Defb22	C	A	2: 152,485,906	A120S	unknown	Het
Dnah7b	A	G	1: 46,188,659	I1347M	probably damaging	Het
Efcab5	A	G	11: 77,134,842	I549T	possibly damaging	Het
Esp15	T	A	17: 39,644,577		probably null	Het
Fbxo7	A	G	10: 86,024,654	T42A	probably benign	Het
Filip1	A	G	9: 79,818,274	I1021T	probably benign	Het
Gad1	C	A	2: 70,563,851	S7*	probably null	Het
Gm281	C	A	14: 13,914,438	M1I	probably null	Het
H2-Q7	C	T	17: 35,439,542	T52M	probably damaging	Het
H2-T3	C	T	17: 36,186,702	G28R	probably benign	Het
Hist1h2ad	T	A	13: 23,574,667		probably null	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ift81	A	G	5: 122,555,535	Y604H	probably damaging	Het
Igsf11	A	G	16: 39,022,423	Y154C	probably damaging	Het
Kif26b	G	T	1: 178,914,876	A846S	probably benign	Het
Lnx2	G	A	5: 147,028,154	P420S	probably benign	Het
Lrit2	A	G	14: 37,072,259	T427A	probably damaging	Het
Lrrc43	G	T	5: 123,499,671		probably null	Het
Mug1	T	C	6: 121,884,394	Y1325H	probably damaging	Het
Naglu	A	T	11: 101,076,724	Y500F	probably damaging	Het
Npy4r	A	G	14: 34,146,983	M116T	probably benign	Het
Nrd1	A	G	4: 109,039,762	Y526C	probably damaging	Het
Nrp2	T	C	1: 62,762,813	S472P	probably benign	Het
Olfr102	T	A	17: 37,314,292	T31S	probably benign	Het
Olfr361	T	C	2: 37,085,719	T10A	possibly damaging	Het
Otogl	T	A	10: 107,780,933	T1828S	probably benign	Het
Pank2	C	T	2: 131,274,262	T200I	probably benign	Het
Pbrm1	A	G	14: 31,082,610	Y946C	probably damaging	Het
Pde12	A	T	14: 26,666,453	S437T	probably benign	Het
Pikfyve	A	G	1: 65,265,268	K1710E	possibly damaging	Het
Plcd3	A	G	11: 103,078,455	S229P	probably damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ptprg	T	A	14: 12,153,873	S531R	probably damaging	Het
R3hdm2	T	C	10: 127,485,434	S620P	probably damaging	Het
Rab33b	A	G	3: 51,493,455	T117A	probably damaging	Het
Rasal2	T	C	1: 157,157,765	D804G	possibly damaging	Het
Rbp3	A	G	14: 33,956,413	T773A	possibly damaging	Het
Rrnad1	A	T	3: 87,930,011		probably benign	Het
Rspry1	A	G	8: 94,638,286	T185A	possibly damaging	Het
Sec61a2	G	T	2: 5,882,545		probably benign	Het
Setx	C	T	2: 29,147,594	R1364C	probably benign	Het
Shtn1	G	T	19: 59,038,369	L97M	probably damaging	Het
Slc35f1	T	C	10: 53,108,164	L340P	probably damaging	Het
Slc45a1	T	A	4: 150,643,909		probably benign	Het
Slmap	T	C	14: 26,459,933	E386G	probably benign	Het
Smc2	C	T	4: 52,475,096	A924V	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Tecta	G	A	9: 42,375,063	L766F	probably damaging	Het
Tle3	C	T	9: 61,407,489		probably null	Het
Top3a	A	G	11: 60,762,490	F53L	probably damaging	Het
Trem1	T	C	17: 48,241,513	I26T	possibly damaging	Het
Ttc7b	G	T	12: 100,446,963	Q199K	possibly damaging	Het
Ubap2l	T	C	3: 90,006,596	Y975C	probably benign	Het
Ubxn11	C	A	4: 134,123,426	D196E	probably damaging	Het
Unc80	A	G	1: 66,530,021	H945R	possibly damaging	Het
Usp15	A	G	10: 123,131,286	I405T	probably damaging	Het
Uty	C	T	Y: 1,189,339	E138K	probably damaging	Het
Wapl	A	G	14: 34,677,295	E107G	probably benign	Het
Wbp1l	T	C	19: 46,644,457		probably null	Het
Zfp184	T	G	13: 21,949,640		probably benign	Het
Zfp36	A	C	7: 28,377,868	L205R	possibly damaging	Het

Other mutations in Prkaa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01020:Prkaa2	APN	4	105075462	missense	probably damaging	1.00
IGL01350:Prkaa2	APN	4	105051912	splice site	probably null
IGL01474:Prkaa2	APN	4	105049332	critical splice donor site	probably null
IGL02149:Prkaa2	APN	4	105040088	missense	probably benign	0.01
IGL02187:Prkaa2	APN	4	105047166	missense	probably benign	0.10
IGL03185:Prkaa2	APN	4	105039721	critical splice donor site	probably null
R0004:Prkaa2	UTSW	4	105047091	missense	probably null	1.00
R1536:Prkaa2	UTSW	4	105075450	missense	probably damaging	1.00
R1588:Prkaa2	UTSW	4	105051223	missense	probably damaging	0.96
R1596:Prkaa2	UTSW	4	105036329	missense	probably damaging	1.00
R1920:Prkaa2	UTSW	4	105036753	nonsense	probably null
R2356:Prkaa2	UTSW	4	105039721	critical splice donor site	probably null
R2995:Prkaa2	UTSW	4	105052007	missense	probably damaging	1.00
R4037:Prkaa2	UTSW	4	105051247	missense	probably damaging	1.00
R4038:Prkaa2	UTSW	4	105051247	missense	probably damaging	1.00
R4039:Prkaa2	UTSW	4	105051247	missense	probably damaging	1.00
R4257:Prkaa2	UTSW	4	105039956	missense	probably benign	0.00
R4810:Prkaa2	UTSW	4	105039814	missense	probably damaging	1.00
R5813:Prkaa2	UTSW	4	105036094	makesense	probably null
R6812:Prkaa2	UTSW	4	105047152	missense	probably benign
R7417:Prkaa2	UTSW	4	105075543	missense	probably benign	0.05
R8156:Prkaa2	UTSW	4	105051975	missense	probably benign	0.44
R8326:Prkaa2	UTSW	4	105036298	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- AGAACTCACTGGCTTGGTTC -3'
(R):5'- TAATTAACTGGAGTAGGGGCACATG -3'

Sequencing Primer
(F):5'- GAACTCACTGGCTTGGTTCATTATTC -3'
(R):5'- ATTAACTGGTGTAGGGCCACATAGTC -3'

Posted On

2016-08-04