Incidental Mutation 'R5387:Nrd1'
ID425322
Institutional Source Beutler Lab
Gene Symbol Nrd1
Ensembl Gene ENSMUSG00000053510
Gene Namenardilysin, N-arginine dibasic convertase, NRD convertase 1
SynonymsNRD-C
MMRRC Submission 042959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R5387 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location109000655-109061777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109039762 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 526 (Y526C)
Ref Sequence ENSEMBL: ENSMUSP00000068328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065977] [ENSMUST00000102736] [ENSMUST00000106644] [ENSMUST00000125645]
Predicted Effect probably damaging
Transcript: ENSMUST00000065977
AA Change: Y526C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068328
Gene: ENSMUSG00000053510
AA Change: Y526C

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.1e-43 PFAM
Pfam:Peptidase_M16_C 373 559 2.3e-22 PFAM
Pfam:Peptidase_M16_C 849 1032 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102736
AA Change: Y482C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099797
Gene: ENSMUSG00000053510
AA Change: Y482C

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.4e-43 PFAM
Pfam:Peptidase_M16_C 400 515 1.1e-9 PFAM
Pfam:Peptidase_M16_C 805 988 2e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106644
AA Change: Y594C

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102255
Gene: ENSMUSG00000053510
AA Change: Y594C

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
coiled coil region 187 225 N/A INTRINSIC
Pfam:Peptidase_M16 281 416 1e-41 PFAM
Pfam:Peptidase_M16_C 441 627 2.2e-23 PFAM
Pfam:Peptidase_M16_M 631 913 1e-91 PFAM
Pfam:Peptidase_M16_C 917 1100 6e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125645
AA Change: Y278C

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122808
Gene: ENSMUSG00000053510
AA Change: Y278C

DomainStartEndE-ValueType
Pfam:Peptidase_M16 1 100 6.4e-27 PFAM
Pfam:Peptidase_M16_C 125 311 1.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150784
Meta Mutation Damage Score 0.4892 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent endopeptidase that cleaves peptide substrates at the N-terminus of arginine residues in dibasic moieties and is a member of the peptidase M16 family. This protein interacts with heparin-binding EGF-like growth factor and plays a role in cell migration and proliferation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele mostly die within 48 hours of birth with surviving mice exhibiting cortical thinning, enlarged lateral ventricles, hypomyelination, reduced grip strength, impaired coordination, and impaired spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,685,974 D32E probably benign Het
2210408I21Rik T A 13: 77,259,973 S140T probably benign Het
Ahnak T C 19: 9,003,691 S780P probably damaging Het
Ankhd1 C A 18: 36,634,644 H1205N probably damaging Het
Ano1 T C 7: 144,648,619 K139R probably benign Het
Anp32b T G 4: 46,468,573 C114W probably damaging Het
Ascl1 C T 10: 87,492,689 A134T probably damaging Het
Atl2 C T 17: 79,852,800 E453K probably benign Het
Aup1 C T 6: 83,055,024 A84V probably damaging Het
Btbd7 A T 12: 102,837,785 M332K probably damaging Het
Cacna1d A G 14: 30,100,751 V1107A probably damaging Het
Cd33 G A 7: 43,532,053 Q114* probably null Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Defb22 C A 2: 152,485,906 A120S unknown Het
Dnah7b A G 1: 46,188,659 I1347M probably damaging Het
Efcab5 A G 11: 77,134,842 I549T possibly damaging Het
Esp15 T A 17: 39,644,577 probably null Het
Fbxo7 A G 10: 86,024,654 T42A probably benign Het
Filip1 A G 9: 79,818,274 I1021T probably benign Het
Gad1 C A 2: 70,563,851 S7* probably null Het
Gm281 C A 14: 13,914,438 M1I probably null Het
H2-Q7 C T 17: 35,439,542 T52M probably damaging Het
H2-T3 C T 17: 36,186,702 G28R probably benign Het
Hist1h2ad T A 13: 23,574,667 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift81 A G 5: 122,555,535 Y604H probably damaging Het
Igsf11 A G 16: 39,022,423 Y154C probably damaging Het
Kif26b G T 1: 178,914,876 A846S probably benign Het
Lnx2 G A 5: 147,028,154 P420S probably benign Het
Lrit2 A G 14: 37,072,259 T427A probably damaging Het
Lrrc43 G T 5: 123,499,671 probably null Het
Mug1 T C 6: 121,884,394 Y1325H probably damaging Het
Naglu A T 11: 101,076,724 Y500F probably damaging Het
Npy4r A G 14: 34,146,983 M116T probably benign Het
Nrp2 T C 1: 62,762,813 S472P probably benign Het
Olfr102 T A 17: 37,314,292 T31S probably benign Het
Olfr361 T C 2: 37,085,719 T10A possibly damaging Het
Otogl T A 10: 107,780,933 T1828S probably benign Het
Pank2 C T 2: 131,274,262 T200I probably benign Het
Pbrm1 A G 14: 31,082,610 Y946C probably damaging Het
Pde12 A T 14: 26,666,453 S437T probably benign Het
Pikfyve A G 1: 65,265,268 K1710E possibly damaging Het
Plcd3 A G 11: 103,078,455 S229P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkaa2 C A 4: 105,040,177 D280Y probably damaging Het
Ptprg T A 14: 12,153,873 S531R probably damaging Het
R3hdm2 T C 10: 127,485,434 S620P probably damaging Het
Rab33b A G 3: 51,493,455 T117A probably damaging Het
Rasal2 T C 1: 157,157,765 D804G possibly damaging Het
Rbp3 A G 14: 33,956,413 T773A possibly damaging Het
Rrnad1 A T 3: 87,930,011 probably benign Het
Rspry1 A G 8: 94,638,286 T185A possibly damaging Het
Sec61a2 G T 2: 5,882,545 probably benign Het
Setx C T 2: 29,147,594 R1364C probably benign Het
Shtn1 G T 19: 59,038,369 L97M probably damaging Het
Slc35f1 T C 10: 53,108,164 L340P probably damaging Het
Slc45a1 T A 4: 150,643,909 probably benign Het
Slmap T C 14: 26,459,933 E386G probably benign Het
Smc2 C T 4: 52,475,096 A924V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Tecta G A 9: 42,375,063 L766F probably damaging Het
Tle3 C T 9: 61,407,489 probably null Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Trem1 T C 17: 48,241,513 I26T possibly damaging Het
Ttc7b G T 12: 100,446,963 Q199K possibly damaging Het
Ubap2l T C 3: 90,006,596 Y975C probably benign Het
Ubxn11 C A 4: 134,123,426 D196E probably damaging Het
Unc80 A G 1: 66,530,021 H945R possibly damaging Het
Usp15 A G 10: 123,131,286 I405T probably damaging Het
Uty C T Y: 1,189,339 E138K probably damaging Het
Wapl A G 14: 34,677,295 E107G probably benign Het
Wbp1l T C 19: 46,644,457 probably null Het
Zfp184 T G 13: 21,949,640 probably benign Het
Zfp36 A C 7: 28,377,868 L205R possibly damaging Het
Other mutations in Nrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Nrd1 APN 4 109046687 unclassified probably benign
IGL00857:Nrd1 APN 4 109054002 missense probably damaging 1.00
IGL01417:Nrd1 APN 4 109000830 utr 5 prime probably benign
IGL01457:Nrd1 APN 4 109047660 missense probably benign 0.03
IGL02112:Nrd1 APN 4 109027432 splice site probably benign
IGL02279:Nrd1 APN 4 109024194 splice site probably benign
IGL02332:Nrd1 APN 4 109000988 missense probably damaging 0.99
IGL02890:Nrd1 APN 4 109053919 missense possibly damaging 0.55
IGL03179:Nrd1 APN 4 109046691 unclassified probably benign
PIT4354001:Nrd1 UTSW 4 109054025 critical splice donor site probably null
R0551:Nrd1 UTSW 4 109047708 missense probably damaging 1.00
R1468:Nrd1 UTSW 4 109016668 missense probably benign 0.01
R1468:Nrd1 UTSW 4 109016668 missense probably benign 0.01
R1990:Nrd1 UTSW 4 109039775 nonsense probably null
R4391:Nrd1 UTSW 4 109046644 missense probably damaging 1.00
R4994:Nrd1 UTSW 4 109046612 missense probably benign
R5164:Nrd1 UTSW 4 109039717 missense probably damaging 0.99
R5229:Nrd1 UTSW 4 109049108 missense probably damaging 1.00
R5530:Nrd1 UTSW 4 109047609 missense probably damaging 0.96
R5672:Nrd1 UTSW 4 109038045 nonsense probably null
R5990:Nrd1 UTSW 4 109019071 missense probably damaging 1.00
R6018:Nrd1 UTSW 4 109013747 missense probably benign 0.01
R6106:Nrd1 UTSW 4 109044585 missense probably damaging 0.99
R6114:Nrd1 UTSW 4 109044585 missense probably damaging 0.99
R6140:Nrd1 UTSW 4 109049111 missense probably damaging 0.97
R6285:Nrd1 UTSW 4 109038006 missense probably damaging 0.99
R6824:Nrd1 UTSW 4 109043425 missense probably damaging 1.00
R7019:Nrd1 UTSW 4 109028802 missense probably benign 0.33
R7353:Nrd1 UTSW 4 109039749 missense probably damaging 1.00
R7735:Nrd1 UTSW 4 109037985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTACATCAAAAGCTCAGGTTCC -3'
(R):5'- CCTGAAGTCAGAGTTGTACTAGGTC -3'

Sequencing Primer
(F):5'- CAAAAGCTCAGGTTCCAAAATTTTAC -3'
(R):5'- GTACTAGGTCTTAGTTTCATCCTCAG -3'
Posted On2016-08-04