Incidental Mutation 'R5387:Slc45a1'
ID 425324
Institutional Source Beutler Lab
Gene Symbol Slc45a1
Ensembl Gene ENSMUSG00000039838
Gene Name solute carrier family 45, member 1
Synonyms Dnb5
MMRRC Submission 042959-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R5387 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 150713052-150736631 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 150728366 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037827] [ENSMUST00000117997]
AlphaFold Q8BIV7
Predicted Effect probably benign
Transcript: ENSMUST00000037827
SMART Domains Protein: ENSMUSP00000036774
Gene: ENSMUSG00000039838

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
Pfam:MFS_2 86 310 7.3e-11 PFAM
Pfam:MFS_1 92 356 1.4e-12 PFAM
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 604 626 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
transmembrane domain 680 702 N/A INTRINSIC
transmembrane domain 712 734 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117997
SMART Domains Protein: ENSMUSP00000112737
Gene: ENSMUSG00000039838

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
Pfam:MFS_2 87 307 1.6e-12 PFAM
Pfam:MFS_1 92 362 2.4e-12 PFAM
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 604 626 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147706
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was isolated initially from a region on chromosome 1p that is frequently deleted in human neuroblastoma, although no causal relationship has since been demonstrated. The encoded protein belongs to the glycoside-pentoside-hexuronide cation symporter transporter family and may play a role in glucose uptake. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,408,092 (GRCm39) S140T probably benign Het
Ahnak T C 19: 8,981,055 (GRCm39) S780P probably damaging Het
Ankhd1 C A 18: 36,767,697 (GRCm39) H1205N probably damaging Het
Ano1 T C 7: 144,202,356 (GRCm39) K139R probably benign Het
Anp32b T G 4: 46,468,573 (GRCm39) C114W probably damaging Het
Ascl1 C T 10: 87,328,551 (GRCm39) A134T probably damaging Het
Atl2 C T 17: 80,160,229 (GRCm39) E453K probably benign Het
Aup1 C T 6: 83,032,005 (GRCm39) A84V probably damaging Het
Btbd7 A T 12: 102,804,044 (GRCm39) M332K probably damaging Het
Cacna1d A G 14: 29,822,708 (GRCm39) V1107A probably damaging Het
Cd33 G A 7: 43,181,477 (GRCm39) Q114* probably null Het
Cdhr18 C A 14: 13,914,438 (GRCm38) M1I probably null Het
Col4a4 C T 1: 82,471,312 (GRCm39) G681E unknown Het
Defb22 C A 2: 152,327,826 (GRCm39) A120S unknown Het
Dnah7b A G 1: 46,227,819 (GRCm39) I1347M probably damaging Het
Efcab5 A G 11: 77,025,668 (GRCm39) I549T possibly damaging Het
Esp15 T A 17: 39,955,468 (GRCm39) probably null Het
Fbxo7 A G 10: 85,860,518 (GRCm39) T42A probably benign Het
Filip1 A G 9: 79,725,556 (GRCm39) I1021T probably benign Het
Gad1 C A 2: 70,394,195 (GRCm39) S7* probably null Het
H2ac7 T A 13: 23,758,841 (GRCm39) probably null Het
H2-Q7 C T 17: 35,658,518 (GRCm39) T52M probably damaging Het
H2-T3 C T 17: 36,497,594 (GRCm39) G28R probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Ift81 A G 5: 122,693,598 (GRCm39) Y604H probably damaging Het
Igsf11 A G 16: 38,842,785 (GRCm39) Y154C probably damaging Het
Kif26b G T 1: 178,742,441 (GRCm39) A846S probably benign Het
Lnx2 G A 5: 146,964,964 (GRCm39) P420S probably benign Het
Lrit2 A G 14: 36,794,216 (GRCm39) T427A probably damaging Het
Lrrc43 G T 5: 123,637,734 (GRCm39) probably null Het
Mettl25b A T 3: 87,837,318 (GRCm39) probably benign Het
Mug1 T C 6: 121,861,353 (GRCm39) Y1325H probably damaging Het
Naglu A T 11: 100,967,550 (GRCm39) Y500F probably damaging Het
Npy4r A G 14: 33,868,940 (GRCm39) M116T probably benign Het
Nrdc A G 4: 108,896,959 (GRCm39) Y526C probably damaging Het
Nrp2 T C 1: 62,801,972 (GRCm39) S472P probably benign Het
Or12d2 T A 17: 37,625,183 (GRCm39) T31S probably benign Het
Or12k8 T C 2: 36,975,731 (GRCm39) T10A possibly damaging Het
Otogl T A 10: 107,616,794 (GRCm39) T1828S probably benign Het
Pank2 C T 2: 131,116,182 (GRCm39) T200I probably benign Het
Pbrm1 A G 14: 30,804,567 (GRCm39) Y946C probably damaging Het
Pde12 A T 14: 26,387,608 (GRCm39) S437T probably benign Het
Pikfyve A G 1: 65,304,427 (GRCm39) K1710E possibly damaging Het
Plcd3 A G 11: 102,969,281 (GRCm39) S229P probably damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Prkaa2 C A 4: 104,897,374 (GRCm39) D280Y probably damaging Het
Ptprg T A 14: 12,153,873 (GRCm38) S531R probably damaging Het
R3hdm2 T C 10: 127,321,303 (GRCm39) S620P probably damaging Het
Rab33b A G 3: 51,400,876 (GRCm39) T117A probably damaging Het
Rasal2 T C 1: 156,985,335 (GRCm39) D804G possibly damaging Het
Rbp3 A G 14: 33,678,370 (GRCm39) T773A possibly damaging Het
Rspry1 A G 8: 95,364,914 (GRCm39) T185A possibly damaging Het
Sec61a2 G T 2: 5,887,356 (GRCm39) probably benign Het
Setx C T 2: 29,037,606 (GRCm39) R1364C probably benign Het
Shtn1 G T 19: 59,026,801 (GRCm39) L97M probably damaging Het
Slc35f1 T C 10: 52,984,260 (GRCm39) L340P probably damaging Het
Slmap T C 14: 26,181,088 (GRCm39) E386G probably benign Het
Smc2 C T 4: 52,475,096 (GRCm39) A924V probably benign Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Tecta G A 9: 42,286,359 (GRCm39) L766F probably damaging Het
Tle3 C T 9: 61,314,771 (GRCm39) probably null Het
Top3a A G 11: 60,653,316 (GRCm39) F53L probably damaging Het
Trappc2b A T 11: 51,576,801 (GRCm39) D32E probably benign Het
Trem1 T C 17: 48,548,541 (GRCm39) I26T possibly damaging Het
Ttc7b G T 12: 100,413,222 (GRCm39) Q199K possibly damaging Het
Ubap2l T C 3: 89,913,903 (GRCm39) Y975C probably benign Het
Ubxn11 C A 4: 133,850,737 (GRCm39) D196E probably damaging Het
Unc80 A G 1: 66,569,180 (GRCm39) H945R possibly damaging Het
Usp15 A G 10: 122,967,191 (GRCm39) I405T probably damaging Het
Uty C T Y: 1,189,339 (GRCm39) E138K probably damaging Het
Wapl A G 14: 34,399,252 (GRCm39) E107G probably benign Het
Wbp1l T C 19: 46,632,896 (GRCm39) probably null Het
Zfp184 T G 13: 22,133,810 (GRCm39) probably benign Het
Zfp36 A C 7: 28,077,293 (GRCm39) L205R possibly damaging Het
Other mutations in Slc45a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Slc45a1 APN 4 150,728,426 (GRCm39) missense probably damaging 1.00
IGL02009:Slc45a1 APN 4 150,722,447 (GRCm39) missense probably damaging 1.00
IGL02251:Slc45a1 APN 4 150,723,176 (GRCm39) splice site probably benign
IGL02752:Slc45a1 APN 4 150,722,478 (GRCm39) missense probably benign 0.01
IGL02881:Slc45a1 APN 4 150,722,987 (GRCm39) missense probably benign 0.36
PIT4508001:Slc45a1 UTSW 4 150,722,892 (GRCm39) missense probably benign 0.00
R0017:Slc45a1 UTSW 4 150,714,023 (GRCm39) missense possibly damaging 0.56
R0017:Slc45a1 UTSW 4 150,714,023 (GRCm39) missense possibly damaging 0.56
R0449:Slc45a1 UTSW 4 150,727,762 (GRCm39) missense probably damaging 1.00
R0756:Slc45a1 UTSW 4 150,727,054 (GRCm39) frame shift probably null
R1435:Slc45a1 UTSW 4 150,728,505 (GRCm39) missense probably damaging 1.00
R1837:Slc45a1 UTSW 4 150,722,916 (GRCm39) missense probably benign 0.00
R1943:Slc45a1 UTSW 4 150,728,734 (GRCm39) missense probably benign 0.02
R2186:Slc45a1 UTSW 4 150,722,708 (GRCm39) missense probably benign 0.01
R3766:Slc45a1 UTSW 4 150,722,517 (GRCm39) missense probably damaging 1.00
R4689:Slc45a1 UTSW 4 150,722,996 (GRCm39) missense probably benign 0.31
R4697:Slc45a1 UTSW 4 150,722,741 (GRCm39) missense probably damaging 1.00
R4709:Slc45a1 UTSW 4 150,722,697 (GRCm39) missense probably benign 0.04
R5253:Slc45a1 UTSW 4 150,722,727 (GRCm39) missense probably damaging 0.98
R5914:Slc45a1 UTSW 4 150,713,997 (GRCm39) missense possibly damaging 0.57
R6259:Slc45a1 UTSW 4 150,722,817 (GRCm39) missense possibly damaging 0.63
R6290:Slc45a1 UTSW 4 150,727,096 (GRCm39) missense probably damaging 1.00
R6961:Slc45a1 UTSW 4 150,714,110 (GRCm39) missense probably damaging 0.99
R6981:Slc45a1 UTSW 4 150,723,051 (GRCm39) missense possibly damaging 0.48
R7099:Slc45a1 UTSW 4 150,714,030 (GRCm39) missense probably benign 0.00
R7209:Slc45a1 UTSW 4 150,719,669 (GRCm39) splice site probably null
R7601:Slc45a1 UTSW 4 150,713,994 (GRCm39) missense possibly damaging 0.78
R7615:Slc45a1 UTSW 4 150,723,002 (GRCm39) missense probably benign 0.01
R7730:Slc45a1 UTSW 4 150,715,397 (GRCm39) missense probably damaging 1.00
R7750:Slc45a1 UTSW 4 150,728,498 (GRCm39) missense probably damaging 1.00
R8022:Slc45a1 UTSW 4 150,722,766 (GRCm39) missense possibly damaging 0.71
R8768:Slc45a1 UTSW 4 150,714,206 (GRCm39) missense probably damaging 0.98
R9006:Slc45a1 UTSW 4 150,722,731 (GRCm39) missense probably damaging 1.00
R9258:Slc45a1 UTSW 4 150,723,071 (GRCm39) missense possibly damaging 0.88
R9388:Slc45a1 UTSW 4 150,727,067 (GRCm39) missense probably damaging 1.00
R9768:Slc45a1 UTSW 4 150,722,982 (GRCm39) missense probably benign
X0026:Slc45a1 UTSW 4 150,728,507 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATTATGCACTGCCAGC -3'
(R):5'- TGGGAACTGCTCTTCAATGGC -3'

Sequencing Primer
(F):5'- CAGATTATGCACTGCCAGCTTGATG -3'
(R):5'- AACTGCTCTTCAATGGCTGCATTC -3'
Posted On 2016-08-04