Incidental Mutation 'R5387:Ift81'
ID425326
Institutional Source Beutler Lab
Gene Symbol Ift81
Ensembl Gene ENSMUSG00000029469
Gene Nameintraflagellar transport 81
SynonymsCDV-1R, Cdv1
MMRRC Submission 042959-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5387 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122550204-122614518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122555535 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 604 (Y604H)
Ref Sequence ENSEMBL: ENSMUSP00000031426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031426]
Predicted Effect probably damaging
Transcript: ENSMUST00000031426
AA Change: Y604H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031426
Gene: ENSMUSG00000029469
AA Change: Y604H

DomainStartEndE-ValueType
PDB:4LVP|A 5 128 2e-23 PDB
coiled coil region 167 258 N/A INTRINSIC
coiled coil region 308 383 N/A INTRINSIC
coiled coil region 503 591 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135956
Meta Mutation Damage Score 0.2019 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with IFT74, forms a tubulin-binding module of intraflagellar transport complex B. This module is involved in transport of tubulin within the cilium, and the encoded protein is required for ciliogenesis. Mutations in this gene are a cause of short-rib polydactyly syndromes. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,685,974 D32E probably benign Het
2210408I21Rik T A 13: 77,259,973 S140T probably benign Het
Ahnak T C 19: 9,003,691 S780P probably damaging Het
Ankhd1 C A 18: 36,634,644 H1205N probably damaging Het
Ano1 T C 7: 144,648,619 K139R probably benign Het
Anp32b T G 4: 46,468,573 C114W probably damaging Het
Ascl1 C T 10: 87,492,689 A134T probably damaging Het
Atl2 C T 17: 79,852,800 E453K probably benign Het
Aup1 C T 6: 83,055,024 A84V probably damaging Het
Btbd7 A T 12: 102,837,785 M332K probably damaging Het
Cacna1d A G 14: 30,100,751 V1107A probably damaging Het
Cd33 G A 7: 43,532,053 Q114* probably null Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Defb22 C A 2: 152,485,906 A120S unknown Het
Dnah7b A G 1: 46,188,659 I1347M probably damaging Het
Efcab5 A G 11: 77,134,842 I549T possibly damaging Het
Esp15 T A 17: 39,644,577 probably null Het
Fbxo7 A G 10: 86,024,654 T42A probably benign Het
Filip1 A G 9: 79,818,274 I1021T probably benign Het
Gad1 C A 2: 70,563,851 S7* probably null Het
Gm281 C A 14: 13,914,438 M1I probably null Het
H2-Q7 C T 17: 35,439,542 T52M probably damaging Het
H2-T3 C T 17: 36,186,702 G28R probably benign Het
Hist1h2ad T A 13: 23,574,667 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igsf11 A G 16: 39,022,423 Y154C probably damaging Het
Kif26b G T 1: 178,914,876 A846S probably benign Het
Lnx2 G A 5: 147,028,154 P420S probably benign Het
Lrit2 A G 14: 37,072,259 T427A probably damaging Het
Lrrc43 G T 5: 123,499,671 probably null Het
Mug1 T C 6: 121,884,394 Y1325H probably damaging Het
Naglu A T 11: 101,076,724 Y500F probably damaging Het
Npy4r A G 14: 34,146,983 M116T probably benign Het
Nrd1 A G 4: 109,039,762 Y526C probably damaging Het
Nrp2 T C 1: 62,762,813 S472P probably benign Het
Olfr102 T A 17: 37,314,292 T31S probably benign Het
Olfr361 T C 2: 37,085,719 T10A possibly damaging Het
Otogl T A 10: 107,780,933 T1828S probably benign Het
Pank2 C T 2: 131,274,262 T200I probably benign Het
Pbrm1 A G 14: 31,082,610 Y946C probably damaging Het
Pde12 A T 14: 26,666,453 S437T probably benign Het
Pikfyve A G 1: 65,265,268 K1710E possibly damaging Het
Plcd3 A G 11: 103,078,455 S229P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkaa2 C A 4: 105,040,177 D280Y probably damaging Het
Ptprg T A 14: 12,153,873 S531R probably damaging Het
R3hdm2 T C 10: 127,485,434 S620P probably damaging Het
Rab33b A G 3: 51,493,455 T117A probably damaging Het
Rasal2 T C 1: 157,157,765 D804G possibly damaging Het
Rbp3 A G 14: 33,956,413 T773A possibly damaging Het
Rrnad1 A T 3: 87,930,011 probably benign Het
Rspry1 A G 8: 94,638,286 T185A possibly damaging Het
Sec61a2 G T 2: 5,882,545 probably benign Het
Setx C T 2: 29,147,594 R1364C probably benign Het
Shtn1 G T 19: 59,038,369 L97M probably damaging Het
Slc35f1 T C 10: 53,108,164 L340P probably damaging Het
Slc45a1 T A 4: 150,643,909 probably benign Het
Slmap T C 14: 26,459,933 E386G probably benign Het
Smc2 C T 4: 52,475,096 A924V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Tecta G A 9: 42,375,063 L766F probably damaging Het
Tle3 C T 9: 61,407,489 probably null Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Trem1 T C 17: 48,241,513 I26T possibly damaging Het
Ttc7b G T 12: 100,446,963 Q199K possibly damaging Het
Ubap2l T C 3: 90,006,596 Y975C probably benign Het
Ubxn11 C A 4: 134,123,426 D196E probably damaging Het
Unc80 A G 1: 66,530,021 H945R possibly damaging Het
Usp15 A G 10: 123,131,286 I405T probably damaging Het
Uty C T Y: 1,189,339 E138K probably damaging Het
Wapl A G 14: 34,677,295 E107G probably benign Het
Wbp1l T C 19: 46,644,457 probably null Het
Zfp184 T G 13: 21,949,640 probably benign Het
Zfp36 A C 7: 28,377,868 L205R possibly damaging Het
Other mutations in Ift81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Ift81 APN 5 122610968 missense probably damaging 1.00
IGL01867:Ift81 APN 5 122602676 splice site probably benign
IGL01927:Ift81 APN 5 122593129 missense probably benign 0.25
IGL02954:Ift81 APN 5 122610185 splice site probably benign
IGL03003:Ift81 APN 5 122594662 missense probably benign 0.01
R1179:Ift81 UTSW 5 122602710 missense probably benign 0.22
R1394:Ift81 UTSW 5 122568923 missense probably benign 0.00
R1395:Ift81 UTSW 5 122568923 missense probably benign 0.00
R1962:Ift81 UTSW 5 122560709 missense probably benign 0.01
R2084:Ift81 UTSW 5 122567347 missense probably benign 0.00
R4019:Ift81 UTSW 5 122593129 missense probably benign 0.25
R4769:Ift81 UTSW 5 122594593 missense probably benign 0.16
R4849:Ift81 UTSW 5 122591219 missense probably damaging 1.00
R4905:Ift81 UTSW 5 122591079 critical splice donor site probably null
R4924:Ift81 UTSW 5 122594616 missense possibly damaging 0.86
R5110:Ift81 UTSW 5 122551058 missense probably benign 0.02
R5299:Ift81 UTSW 5 122607056 missense probably damaging 0.99
R6190:Ift81 UTSW 5 122551100 missense probably benign 0.00
R6241:Ift81 UTSW 5 122602351 missense probably benign 0.38
R6404:Ift81 UTSW 5 122611006 missense probably damaging 1.00
R6647:Ift81 UTSW 5 122610166 nonsense probably null
R7155:Ift81 UTSW 5 122568999 missense probably damaging 0.99
R7170:Ift81 UTSW 5 122555533 nonsense probably null
R7699:Ift81 UTSW 5 122594560 missense possibly damaging 0.85
R7700:Ift81 UTSW 5 122594560 missense possibly damaging 0.85
R7709:Ift81 UTSW 5 122609331 missense probably damaging 1.00
R7756:Ift81 UTSW 5 122551025 missense probably damaging 1.00
R7758:Ift81 UTSW 5 122551025 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAGCACCACCTCTCTG -3'
(R):5'- CACGGGTTGTCAATTTTAAGGG -3'

Sequencing Primer
(F):5'- TCTGGTCCCTTTACTTTCCTAAG -3'
(R):5'- ACGAAGTATCTGATGAGTTC -3'
Posted On2016-08-04