Mutagenetix > Incidental Mutations

Incidental Mutation 'R5387:Ift81'

425326

Institutional Source

Beutler Lab

Gene Symbol

Ift81

Ensembl Gene

ENSMUSG00000029469

Gene Name

intraflagellar transport 81

Synonyms

CDV-1R, Cdv1

MMRRC Submission

042959-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5387 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122550204-122614518 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122555535 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 604 (Y604H)

Ref Sequence

ENSEMBL: ENSMUSP00000031426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031426]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031426
AA Change: Y604H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031426
Gene: ENSMUSG00000029469
AA Change: Y604H

Domain	Start	End	E-Value	Type
PDB:4LVP\|A	5	128	2e-23	PDB
coiled coil region	167	258	N/A	INTRINSIC
coiled coil region	308	383	N/A	INTRINSIC
coiled coil region	503	591	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135956

Meta Mutation Damage Score

0.2019

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with IFT74, forms a tubulin-binding module of intraflagellar transport complex B. This module is involved in transport of tubulin within the cilium, and the encoded protein is required for ciliogenesis. Mutations in this gene are a cause of short-rib polydactyly syndromes. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	A	T	11: 51,685,974	D32E	probably benign	Het
2210408I21Rik	T	A	13: 77,259,973	S140T	probably benign	Het
Ahnak	T	C	19: 9,003,691	S780P	probably damaging	Het
Ankhd1	C	A	18: 36,634,644	H1205N	probably damaging	Het
Ano1	T	C	7: 144,648,619	K139R	probably benign	Het
Anp32b	T	G	4: 46,468,573	C114W	probably damaging	Het
Ascl1	C	T	10: 87,492,689	A134T	probably damaging	Het
Atl2	C	T	17: 79,852,800	E453K	probably benign	Het
Aup1	C	T	6: 83,055,024	A84V	probably damaging	Het
Btbd7	A	T	12: 102,837,785	M332K	probably damaging	Het
Cacna1d	A	G	14: 30,100,751	V1107A	probably damaging	Het
Cd33	G	A	7: 43,532,053	Q114*	probably null	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Defb22	C	A	2: 152,485,906	A120S	unknown	Het
Dnah7b	A	G	1: 46,188,659	I1347M	probably damaging	Het
Efcab5	A	G	11: 77,134,842	I549T	possibly damaging	Het
Esp15	T	A	17: 39,644,577		probably null	Het
Fbxo7	A	G	10: 86,024,654	T42A	probably benign	Het
Filip1	A	G	9: 79,818,274	I1021T	probably benign	Het
Gad1	C	A	2: 70,563,851	S7*	probably null	Het
Gm281	C	A	14: 13,914,438	M1I	probably null	Het
H2-Q7	C	T	17: 35,439,542	T52M	probably damaging	Het
H2-T3	C	T	17: 36,186,702	G28R	probably benign	Het
Hist1h2ad	T	A	13: 23,574,667		probably null	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Igsf11	A	G	16: 39,022,423	Y154C	probably damaging	Het
Kif26b	G	T	1: 178,914,876	A846S	probably benign	Het
Lnx2	G	A	5: 147,028,154	P420S	probably benign	Het
Lrit2	A	G	14: 37,072,259	T427A	probably damaging	Het
Lrrc43	G	T	5: 123,499,671		probably null	Het
Mug1	T	C	6: 121,884,394	Y1325H	probably damaging	Het
Naglu	A	T	11: 101,076,724	Y500F	probably damaging	Het
Npy4r	A	G	14: 34,146,983	M116T	probably benign	Het
Nrd1	A	G	4: 109,039,762	Y526C	probably damaging	Het
Nrp2	T	C	1: 62,762,813	S472P	probably benign	Het
Olfr102	T	A	17: 37,314,292	T31S	probably benign	Het
Olfr361	T	C	2: 37,085,719	T10A	possibly damaging	Het
Otogl	T	A	10: 107,780,933	T1828S	probably benign	Het
Pank2	C	T	2: 131,274,262	T200I	probably benign	Het
Pbrm1	A	G	14: 31,082,610	Y946C	probably damaging	Het
Pde12	A	T	14: 26,666,453	S437T	probably benign	Het
Pikfyve	A	G	1: 65,265,268	K1710E	possibly damaging	Het
Plcd3	A	G	11: 103,078,455	S229P	probably damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Prkaa2	C	A	4: 105,040,177	D280Y	probably damaging	Het
Ptprg	T	A	14: 12,153,873	S531R	probably damaging	Het
R3hdm2	T	C	10: 127,485,434	S620P	probably damaging	Het
Rab33b	A	G	3: 51,493,455	T117A	probably damaging	Het
Rasal2	T	C	1: 157,157,765	D804G	possibly damaging	Het
Rbp3	A	G	14: 33,956,413	T773A	possibly damaging	Het
Rrnad1	A	T	3: 87,930,011		probably benign	Het
Rspry1	A	G	8: 94,638,286	T185A	possibly damaging	Het
Sec61a2	G	T	2: 5,882,545		probably benign	Het
Setx	C	T	2: 29,147,594	R1364C	probably benign	Het
Shtn1	G	T	19: 59,038,369	L97M	probably damaging	Het
Slc35f1	T	C	10: 53,108,164	L340P	probably damaging	Het
Slc45a1	T	A	4: 150,643,909		probably benign	Het
Slmap	T	C	14: 26,459,933	E386G	probably benign	Het
Smc2	C	T	4: 52,475,096	A924V	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Tecta	G	A	9: 42,375,063	L766F	probably damaging	Het
Tle3	C	T	9: 61,407,489		probably null	Het
Top3a	A	G	11: 60,762,490	F53L	probably damaging	Het
Trem1	T	C	17: 48,241,513	I26T	possibly damaging	Het
Ttc7b	G	T	12: 100,446,963	Q199K	possibly damaging	Het
Ubap2l	T	C	3: 90,006,596	Y975C	probably benign	Het
Ubxn11	C	A	4: 134,123,426	D196E	probably damaging	Het
Unc80	A	G	1: 66,530,021	H945R	possibly damaging	Het
Usp15	A	G	10: 123,131,286	I405T	probably damaging	Het
Uty	C	T	Y: 1,189,339	E138K	probably damaging	Het
Wapl	A	G	14: 34,677,295	E107G	probably benign	Het
Wbp1l	T	C	19: 46,644,457		probably null	Het
Zfp184	T	G	13: 21,949,640		probably benign	Het
Zfp36	A	C	7: 28,377,868	L205R	possibly damaging	Het

Other mutations in Ift81

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01321:Ift81	APN	5	122610968	missense	probably damaging	1.00
IGL01867:Ift81	APN	5	122602676	splice site	probably benign
IGL01927:Ift81	APN	5	122593129	missense	probably benign	0.25
IGL02954:Ift81	APN	5	122610185	splice site	probably benign
IGL03003:Ift81	APN	5	122594662	missense	probably benign	0.01
R1179:Ift81	UTSW	5	122602710	missense	probably benign	0.22
R1394:Ift81	UTSW	5	122568923	missense	probably benign	0.00
R1395:Ift81	UTSW	5	122568923	missense	probably benign	0.00
R1962:Ift81	UTSW	5	122560709	missense	probably benign	0.01
R2084:Ift81	UTSW	5	122567347	missense	probably benign	0.00
R4019:Ift81	UTSW	5	122593129	missense	probably benign	0.25
R4769:Ift81	UTSW	5	122594593	missense	probably benign	0.16
R4849:Ift81	UTSW	5	122591219	missense	probably damaging	1.00
R4905:Ift81	UTSW	5	122591079	critical splice donor site	probably null
R4924:Ift81	UTSW	5	122594616	missense	possibly damaging	0.86
R5110:Ift81	UTSW	5	122551058	missense	probably benign	0.02
R5299:Ift81	UTSW	5	122607056	missense	probably damaging	0.99
R6190:Ift81	UTSW	5	122551100	missense	probably benign	0.00
R6241:Ift81	UTSW	5	122602351	missense	probably benign	0.38
R6404:Ift81	UTSW	5	122611006	missense	probably damaging	1.00
R6647:Ift81	UTSW	5	122610166	nonsense	probably null
R7155:Ift81	UTSW	5	122568999	missense	probably damaging	0.99
R7170:Ift81	UTSW	5	122555533	nonsense	probably null
R7699:Ift81	UTSW	5	122594560	missense	possibly damaging	0.85
R7700:Ift81	UTSW	5	122594560	missense	possibly damaging	0.85
R7709:Ift81	UTSW	5	122609331	missense	probably damaging	1.00
R7756:Ift81	UTSW	5	122551025	missense	probably damaging	1.00
R7758:Ift81	UTSW	5	122551025	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCAGCACCACCTCTCTG -3'
(R):5'- CACGGGTTGTCAATTTTAAGGG -3'

Sequencing Primer
(F):5'- TCTGGTCCCTTTACTTTCCTAAG -3'
(R):5'- ACGAAGTATCTGATGAGTTC -3'

Posted On

2016-08-04