Incidental Mutation 'R5387:Tecta'
ID425336
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Nametectorin alpha
Synonyms[a]-tectorin, Tctna
MMRRC Submission 042959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5387 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location42329619-42399929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42375063 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 766 (L766F)
Ref Sequence ENSEMBL: ENSMUSP00000125370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
Predicted Effect probably damaging
Transcript: ENSMUST00000042190
AA Change: L766F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: L766F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160940
AA Change: L766F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: L766F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,685,974 D32E probably benign Het
2210408I21Rik T A 13: 77,259,973 S140T probably benign Het
Ahnak T C 19: 9,003,691 S780P probably damaging Het
Ankhd1 C A 18: 36,634,644 H1205N probably damaging Het
Ano1 T C 7: 144,648,619 K139R probably benign Het
Anp32b T G 4: 46,468,573 C114W probably damaging Het
Ascl1 C T 10: 87,492,689 A134T probably damaging Het
Atl2 C T 17: 79,852,800 E453K probably benign Het
Aup1 C T 6: 83,055,024 A84V probably damaging Het
Btbd7 A T 12: 102,837,785 M332K probably damaging Het
Cacna1d A G 14: 30,100,751 V1107A probably damaging Het
Cd33 G A 7: 43,532,053 Q114* probably null Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Defb22 C A 2: 152,485,906 A120S unknown Het
Dnah7b A G 1: 46,188,659 I1347M probably damaging Het
Efcab5 A G 11: 77,134,842 I549T possibly damaging Het
Esp15 T A 17: 39,644,577 probably null Het
Fbxo7 A G 10: 86,024,654 T42A probably benign Het
Filip1 A G 9: 79,818,274 I1021T probably benign Het
Gad1 C A 2: 70,563,851 S7* probably null Het
Gm281 C A 14: 13,914,438 M1I probably null Het
H2-Q7 C T 17: 35,439,542 T52M probably damaging Het
H2-T3 C T 17: 36,186,702 G28R probably benign Het
Hist1h2ad T A 13: 23,574,667 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift81 A G 5: 122,555,535 Y604H probably damaging Het
Igsf11 A G 16: 39,022,423 Y154C probably damaging Het
Kif26b G T 1: 178,914,876 A846S probably benign Het
Lnx2 G A 5: 147,028,154 P420S probably benign Het
Lrit2 A G 14: 37,072,259 T427A probably damaging Het
Lrrc43 G T 5: 123,499,671 probably null Het
Mug1 T C 6: 121,884,394 Y1325H probably damaging Het
Naglu A T 11: 101,076,724 Y500F probably damaging Het
Npy4r A G 14: 34,146,983 M116T probably benign Het
Nrd1 A G 4: 109,039,762 Y526C probably damaging Het
Nrp2 T C 1: 62,762,813 S472P probably benign Het
Olfr102 T A 17: 37,314,292 T31S probably benign Het
Olfr361 T C 2: 37,085,719 T10A possibly damaging Het
Otogl T A 10: 107,780,933 T1828S probably benign Het
Pank2 C T 2: 131,274,262 T200I probably benign Het
Pbrm1 A G 14: 31,082,610 Y946C probably damaging Het
Pde12 A T 14: 26,666,453 S437T probably benign Het
Pikfyve A G 1: 65,265,268 K1710E possibly damaging Het
Plcd3 A G 11: 103,078,455 S229P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkaa2 C A 4: 105,040,177 D280Y probably damaging Het
Ptprg T A 14: 12,153,873 S531R probably damaging Het
R3hdm2 T C 10: 127,485,434 S620P probably damaging Het
Rab33b A G 3: 51,493,455 T117A probably damaging Het
Rasal2 T C 1: 157,157,765 D804G possibly damaging Het
Rbp3 A G 14: 33,956,413 T773A possibly damaging Het
Rrnad1 A T 3: 87,930,011 probably benign Het
Rspry1 A G 8: 94,638,286 T185A possibly damaging Het
Sec61a2 G T 2: 5,882,545 probably benign Het
Setx C T 2: 29,147,594 R1364C probably benign Het
Shtn1 G T 19: 59,038,369 L97M probably damaging Het
Slc35f1 T C 10: 53,108,164 L340P probably damaging Het
Slc45a1 T A 4: 150,643,909 probably benign Het
Slmap T C 14: 26,459,933 E386G probably benign Het
Smc2 C T 4: 52,475,096 A924V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Tle3 C T 9: 61,407,489 probably null Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Trem1 T C 17: 48,241,513 I26T possibly damaging Het
Ttc7b G T 12: 100,446,963 Q199K possibly damaging Het
Ubap2l T C 3: 90,006,596 Y975C probably benign Het
Ubxn11 C A 4: 134,123,426 D196E probably damaging Het
Unc80 A G 1: 66,530,021 H945R possibly damaging Het
Usp15 A G 10: 123,131,286 I405T probably damaging Het
Uty C T Y: 1,189,339 E138K probably damaging Het
Wapl A G 14: 34,677,295 E107G probably benign Het
Wbp1l T C 19: 46,644,457 probably null Het
Zfp184 T G 13: 21,949,640 probably benign Het
Zfp36 A C 7: 28,377,868 L205R possibly damaging Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42332548 missense probably damaging 1.00
IGL00925:Tecta APN 9 42375035 missense probably benign
IGL00960:Tecta APN 9 42359080 missense possibly damaging 0.74
IGL00974:Tecta APN 9 42331374 missense probably benign 0.00
IGL01070:Tecta APN 9 42395003 missense probably damaging 1.00
IGL01284:Tecta APN 9 42345620 missense probably damaging 1.00
IGL01324:Tecta APN 9 42345431 missense probably damaging 1.00
IGL01694:Tecta APN 9 42367179 missense possibly damaging 0.92
IGL01861:Tecta APN 9 42373362 missense probably benign
IGL02010:Tecta APN 9 42337193 missense probably damaging 0.97
IGL02397:Tecta APN 9 42394998 missense probably damaging 1.00
IGL03031:Tecta APN 9 42345493 missense probably benign
IGL03208:Tecta APN 9 42337100 splice site probably benign
IGL03249:Tecta APN 9 42391886 missense probably benign 0.20
cover UTSW 9 42343887 missense probably benign 0.05
lid UTSW 9 42373110 missense probably damaging 0.99
R0004:Tecta UTSW 9 42345478 missense possibly damaging 0.74
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0119:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0133:Tecta UTSW 9 42367228 missense probably benign 0.00
R0157:Tecta UTSW 9 42375011 missense probably benign
R0180:Tecta UTSW 9 42366813 missense probably benign
R0299:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0345:Tecta UTSW 9 42384218 missense probably damaging 0.98
R0370:Tecta UTSW 9 42366804 missense probably benign
R0465:Tecta UTSW 9 42359418 missense possibly damaging 0.62
R0466:Tecta UTSW 9 42373073 missense probably benign
R0479:Tecta UTSW 9 42337939 missense probably damaging 1.00
R0498:Tecta UTSW 9 42377614 missense probably damaging 1.00
R0499:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0519:Tecta UTSW 9 42347892 splice site probably benign
R0584:Tecta UTSW 9 42347908 missense possibly damaging 0.79
R0589:Tecta UTSW 9 42345634 missense probably benign 0.01
R0607:Tecta UTSW 9 42388205 missense probably damaging 1.00
R0691:Tecta UTSW 9 42384341 missense probably damaging 1.00
R0905:Tecta UTSW 9 42338994 missense probably damaging 1.00
R1216:Tecta UTSW 9 42377907 missense probably benign 0.44
R1239:Tecta UTSW 9 42332485 missense probably damaging 1.00
R1442:Tecta UTSW 9 42332482 missense probably damaging 1.00
R1553:Tecta UTSW 9 42348186 missense probably damaging 1.00
R1727:Tecta UTSW 9 42359301 missense probably damaging 0.96
R1728:Tecta UTSW 9 42391922 missense probably benign 0.12
R1729:Tecta UTSW 9 42391922 missense probably benign 0.12
R1762:Tecta UTSW 9 42375309 missense probably benign 0.30
R1778:Tecta UTSW 9 42343631 missense probably damaging 1.00
R1795:Tecta UTSW 9 42378049 missense probably benign
R1796:Tecta UTSW 9 42384197 missense probably damaging 1.00
R1866:Tecta UTSW 9 42392024 missense probably damaging 0.97
R1871:Tecta UTSW 9 42337176 missense probably damaging 0.98
R1871:Tecta UTSW 9 42337340 missense probably damaging 1.00
R1911:Tecta UTSW 9 42337936 missense probably damaging 1.00
R2074:Tecta UTSW 9 42337279 nonsense probably null
R2135:Tecta UTSW 9 42340285 missense probably damaging 1.00
R2171:Tecta UTSW 9 42358924 missense probably damaging 0.99
R2220:Tecta UTSW 9 42392030 missense probably damaging 1.00
R2372:Tecta UTSW 9 42388274 missense probably damaging 1.00
R2570:Tecta UTSW 9 42332552 missense probably damaging 1.00
R2939:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R2940:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3081:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3407:Tecta UTSW 9 42337854 missense probably damaging 1.00
R3732:Tecta UTSW 9 42392106 missense possibly damaging 0.95
R3771:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3772:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3773:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3832:Tecta UTSW 9 42339033 missense probably damaging 1.00
R4378:Tecta UTSW 9 42366708 missense probably damaging 1.00
R4480:Tecta UTSW 9 42373233 missense possibly damaging 0.75
R4485:Tecta UTSW 9 42337274 missense possibly damaging 0.73
R4804:Tecta UTSW 9 42398237 missense probably benign
R4869:Tecta UTSW 9 42375534 missense probably benign 0.02
R4944:Tecta UTSW 9 42330277 missense probably benign 0.05
R5008:Tecta UTSW 9 42373062 missense possibly damaging 0.76
R5014:Tecta UTSW 9 42373242 missense probably damaging 1.00
R5125:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5178:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5180:Tecta UTSW 9 42337208 missense probably damaging 1.00
R5214:Tecta UTSW 9 42345668 missense probably benign 0.04
R5230:Tecta UTSW 9 42394943 missense probably damaging 0.96
R5330:Tecta UTSW 9 42337856 missense probably damaging 1.00
R5614:Tecta UTSW 9 42339055 missense probably damaging 1.00
R5708:Tecta UTSW 9 42338926 missense probably damaging 1.00
R5738:Tecta UTSW 9 42373178 missense possibly damaging 0.63
R5770:Tecta UTSW 9 42345589 missense possibly damaging 0.94
R5839:Tecta UTSW 9 42331023 missense probably benign 0.03
R5839:Tecta UTSW 9 42372976 missense possibly damaging 0.86
R6119:Tecta UTSW 9 42373075 missense probably benign 0.00
R6246:Tecta UTSW 9 42377908 missense probably benign 0.07
R6377:Tecta UTSW 9 42343755 missense probably damaging 1.00
R6416:Tecta UTSW 9 42375267 missense probably damaging 0.97
R6595:Tecta UTSW 9 42384227 missense probably damaging 1.00
R6850:Tecta UTSW 9 42343838 missense probably benign 0.20
R6859:Tecta UTSW 9 42392129 missense probably damaging 1.00
R6861:Tecta UTSW 9 42337337 missense possibly damaging 0.93
R6939:Tecta UTSW 9 42347997 missense probably damaging 1.00
R6996:Tecta UTSW 9 42366786 missense probably benign
R7069:Tecta UTSW 9 42394941 missense probably benign 0.03
R7104:Tecta UTSW 9 42366943 missense probably benign 0.00
R7129:Tecta UTSW 9 42347991 missense probably damaging 1.00
R7220:Tecta UTSW 9 42343887 missense probably benign 0.05
R7251:Tecta UTSW 9 42387752 missense probably damaging 1.00
R7307:Tecta UTSW 9 42377992 missense probably damaging 1.00
R7343:Tecta UTSW 9 42337332 missense probably damaging 1.00
R7355:Tecta UTSW 9 42367142 nonsense probably null
R7635:Tecta UTSW 9 42330987 missense probably benign 0.11
R7653:Tecta UTSW 9 42337236 missense probably damaging 1.00
R7723:Tecta UTSW 9 42366936 missense probably damaging 1.00
R7939:Tecta UTSW 9 42388223 missense probably damaging 0.99
R7966:Tecta UTSW 9 42394962 missense probably damaging 0.98
R7967:Tecta UTSW 9 42377955 missense possibly damaging 0.95
R8000:Tecta UTSW 9 42367184 nonsense probably null
R8064:Tecta UTSW 9 42394955 missense possibly damaging 0.94
R8117:Tecta UTSW 9 42377631 missense probably damaging 1.00
R8176:Tecta UTSW 9 42359169 missense probably damaging 0.97
R8284:Tecta UTSW 9 42378029 missense possibly damaging 0.89
R8315:Tecta UTSW 9 42387825 critical splice acceptor site probably null
R8321:Tecta UTSW 9 42373053 missense probably damaging 1.00
R8332:Tecta UTSW 9 42375014 missense probably damaging 1.00
R8437:Tecta UTSW 9 42332560 missense probably damaging 0.98
R8496:Tecta UTSW 9 42330251 missense probably benign 0.01
R8514:Tecta UTSW 9 42373110 missense probably damaging 0.99
R8683:Tecta UTSW 9 42366972 missense probably damaging 0.96
Z1176:Tecta UTSW 9 42392094 missense probably damaging 0.99
Z1177:Tecta UTSW 9 42375576 missense probably benign 0.00
Z1177:Tecta UTSW 9 42392070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGATCCATGTCCTCTTTAAGAATC -3'
(R):5'- TGCTTCAACAAGACCTGCCG -3'

Sequencing Primer
(F):5'- GTCCTCTTTAAGAATCAACTCCCAG -3'
(R):5'- TCAACAAGACCTGCCGGAGTG -3'
Posted On2016-08-04