Mutagenetix > Incidental Mutations

Incidental Mutation 'R5387:Tecta'

425336

Institutional Source

Beutler Lab

Gene Symbol

Tecta

Ensembl Gene

ENSMUSG00000037705

Gene Name

tectorin alpha

Synonyms

[a]-tectorin, Tctna

MMRRC Submission

042959-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R5387 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42329619-42399929 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 42375063 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 766 (L766F)

Ref Sequence

ENSEMBL: ENSMUSP00000125370 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]

AlphaFold

O08523

Predicted Effect

probably damaging
Transcript: ENSMUST00000042190
AA Change: L766F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: L766F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
NIDO	98	254	7.88e-77	SMART
VWC	260	314	1.04e0	SMART
VWD	312	477	1.5e-58	SMART
C8	517	592	7.06e-29	SMART
EGF_like	622	645	3.87e1	SMART
VWC	652	713	1.87e-1	SMART
VWD	703	865	4.44e-43	SMART
C8	905	981	9.19e-19	SMART
Pfam:TIL	984	1036	9.8e-13	PFAM
VWD	1090	1257	1.44e-51	SMART
C8	1294	1369	4.64e-15	SMART
EGF_like	1388	1420	5.34e1	SMART
VWC	1427	1487	2.88e-19	SMART
VWD	1477	1638	2.72e-38	SMART
C8	1684	1758	6.51e-10	SMART
ZP	1805	2059	2.95e-85	SMART
EGF	2087	2122	2.07e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160940
AA Change: L766F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: L766F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
NIDO	98	254	7.88e-77	SMART
VWC	260	314	1.04e0	SMART
VWD	312	477	1.5e-58	SMART
C8	517	592	7.06e-29	SMART
EGF_like	622	645	3.87e1	SMART
VWC	652	713	1.87e-1	SMART
VWD	703	865	4.44e-43	SMART
C8	905	981	9.19e-19	SMART
Pfam:TIL	984	1036	6.1e-13	PFAM
VWD	1090	1257	1.44e-51	SMART
C8	1294	1369	4.64e-15	SMART
EGF_like	1388	1420	5.34e1	SMART
VWC	1427	1487	2.88e-19	SMART
VWD	1477	1638	2.72e-38	SMART
C8	1679	1753	6.51e-10	SMART
ZP	1800	2054	2.95e-85	SMART
EGF	2082	2117	2.07e1	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	A	T	11: 51,685,974	D32E	probably benign	Het
2210408I21Rik	T	A	13: 77,259,973	S140T	probably benign	Het
Ahnak	T	C	19: 9,003,691	S780P	probably damaging	Het
Ankhd1	C	A	18: 36,634,644	H1205N	probably damaging	Het
Ano1	T	C	7: 144,648,619	K139R	probably benign	Het
Anp32b	T	G	4: 46,468,573	C114W	probably damaging	Het
Ascl1	C	T	10: 87,492,689	A134T	probably damaging	Het
Atl2	C	T	17: 79,852,800	E453K	probably benign	Het
Aup1	C	T	6: 83,055,024	A84V	probably damaging	Het
Btbd7	A	T	12: 102,837,785	M332K	probably damaging	Het
Cacna1d	A	G	14: 30,100,751	V1107A	probably damaging	Het
Cd33	G	A	7: 43,532,053	Q114*	probably null	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Defb22	C	A	2: 152,485,906	A120S	unknown	Het
Dnah7b	A	G	1: 46,188,659	I1347M	probably damaging	Het
Efcab5	A	G	11: 77,134,842	I549T	possibly damaging	Het
Esp15	T	A	17: 39,644,577		probably null	Het
Fbxo7	A	G	10: 86,024,654	T42A	probably benign	Het
Filip1	A	G	9: 79,818,274	I1021T	probably benign	Het
Gad1	C	A	2: 70,563,851	S7*	probably null	Het
Gm281	C	A	14: 13,914,438	M1I	probably null	Het
H2-Q7	C	T	17: 35,439,542	T52M	probably damaging	Het
H2-T3	C	T	17: 36,186,702	G28R	probably benign	Het
Hist1h2ad	T	A	13: 23,574,667		probably null	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ift81	A	G	5: 122,555,535	Y604H	probably damaging	Het
Igsf11	A	G	16: 39,022,423	Y154C	probably damaging	Het
Kif26b	G	T	1: 178,914,876	A846S	probably benign	Het
Lnx2	G	A	5: 147,028,154	P420S	probably benign	Het
Lrit2	A	G	14: 37,072,259	T427A	probably damaging	Het
Lrrc43	G	T	5: 123,499,671		probably null	Het
Mug1	T	C	6: 121,884,394	Y1325H	probably damaging	Het
Naglu	A	T	11: 101,076,724	Y500F	probably damaging	Het
Npy4r	A	G	14: 34,146,983	M116T	probably benign	Het
Nrd1	A	G	4: 109,039,762	Y526C	probably damaging	Het
Nrp2	T	C	1: 62,762,813	S472P	probably benign	Het
Olfr102	T	A	17: 37,314,292	T31S	probably benign	Het
Olfr361	T	C	2: 37,085,719	T10A	possibly damaging	Het
Otogl	T	A	10: 107,780,933	T1828S	probably benign	Het
Pank2	C	T	2: 131,274,262	T200I	probably benign	Het
Pbrm1	A	G	14: 31,082,610	Y946C	probably damaging	Het
Pde12	A	T	14: 26,666,453	S437T	probably benign	Het
Pikfyve	A	G	1: 65,265,268	K1710E	possibly damaging	Het
Plcd3	A	G	11: 103,078,455	S229P	probably damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Prkaa2	C	A	4: 105,040,177	D280Y	probably damaging	Het
Ptprg	T	A	14: 12,153,873	S531R	probably damaging	Het
R3hdm2	T	C	10: 127,485,434	S620P	probably damaging	Het
Rab33b	A	G	3: 51,493,455	T117A	probably damaging	Het
Rasal2	T	C	1: 157,157,765	D804G	possibly damaging	Het
Rbp3	A	G	14: 33,956,413	T773A	possibly damaging	Het
Rrnad1	A	T	3: 87,930,011		probably benign	Het
Rspry1	A	G	8: 94,638,286	T185A	possibly damaging	Het
Sec61a2	G	T	2: 5,882,545		probably benign	Het
Setx	C	T	2: 29,147,594	R1364C	probably benign	Het
Shtn1	G	T	19: 59,038,369	L97M	probably damaging	Het
Slc35f1	T	C	10: 53,108,164	L340P	probably damaging	Het
Slc45a1	T	A	4: 150,643,909		probably benign	Het
Slmap	T	C	14: 26,459,933	E386G	probably benign	Het
Smc2	C	T	4: 52,475,096	A924V	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Tle3	C	T	9: 61,407,489		probably null	Het
Top3a	A	G	11: 60,762,490	F53L	probably damaging	Het
Trem1	T	C	17: 48,241,513	I26T	possibly damaging	Het
Ttc7b	G	T	12: 100,446,963	Q199K	possibly damaging	Het
Ubap2l	T	C	3: 90,006,596	Y975C	probably benign	Het
Ubxn11	C	A	4: 134,123,426	D196E	probably damaging	Het
Unc80	A	G	1: 66,530,021	H945R	possibly damaging	Het
Usp15	A	G	10: 123,131,286	I405T	probably damaging	Het
Uty	C	T	Y: 1,189,339	E138K	probably damaging	Het
Wapl	A	G	14: 34,677,295	E107G	probably benign	Het
Wbp1l	T	C	19: 46,644,457		probably null	Het
Zfp184	T	G	13: 21,949,640		probably benign	Het
Zfp36	A	C	7: 28,377,868	L205R	possibly damaging	Het

Other mutations in Tecta

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Tecta	APN	9	42332548	missense	probably damaging	1.00
IGL00925:Tecta	APN	9	42375035	missense	probably benign
IGL00960:Tecta	APN	9	42359080	missense	possibly damaging	0.74
IGL00974:Tecta	APN	9	42331374	missense	probably benign	0.00
IGL01070:Tecta	APN	9	42395003	missense	probably damaging	1.00
IGL01284:Tecta	APN	9	42345620	missense	probably damaging	1.00
IGL01324:Tecta	APN	9	42345431	missense	probably damaging	1.00
IGL01694:Tecta	APN	9	42367179	missense	possibly damaging	0.92
IGL01861:Tecta	APN	9	42373362	missense	probably benign
IGL02010:Tecta	APN	9	42337193	missense	probably damaging	0.97
IGL02397:Tecta	APN	9	42394998	missense	probably damaging	1.00
IGL03031:Tecta	APN	9	42345493	missense	probably benign
IGL03208:Tecta	APN	9	42337100	splice site	probably benign
IGL03249:Tecta	APN	9	42391886	missense	probably benign	0.20
cover	UTSW	9	42343887	missense	probably benign	0.05
lid	UTSW	9	42373110	missense	probably damaging	0.99
R0004:Tecta	UTSW	9	42345478	missense	possibly damaging	0.74
R0045:Tecta	UTSW	9	42375191	missense	probably damaging	1.00
R0045:Tecta	UTSW	9	42375191	missense	probably damaging	1.00
R0119:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0133:Tecta	UTSW	9	42367228	missense	probably benign	0.00
R0157:Tecta	UTSW	9	42375011	missense	probably benign
R0180:Tecta	UTSW	9	42366813	missense	probably benign
R0299:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0345:Tecta	UTSW	9	42384218	missense	probably damaging	0.98
R0370:Tecta	UTSW	9	42366804	missense	probably benign
R0465:Tecta	UTSW	9	42359418	missense	possibly damaging	0.62
R0466:Tecta	UTSW	9	42373073	missense	probably benign
R0479:Tecta	UTSW	9	42337939	missense	probably damaging	1.00
R0498:Tecta	UTSW	9	42377614	missense	probably damaging	1.00
R0499:Tecta	UTSW	9	42352063	missense	probably damaging	1.00
R0519:Tecta	UTSW	9	42347892	splice site	probably benign
R0584:Tecta	UTSW	9	42347908	missense	possibly damaging	0.79
R0589:Tecta	UTSW	9	42345634	missense	probably benign	0.01
R0607:Tecta	UTSW	9	42388205	missense	probably damaging	1.00
R0691:Tecta	UTSW	9	42384341	missense	probably damaging	1.00
R0905:Tecta	UTSW	9	42338994	missense	probably damaging	1.00
R1216:Tecta	UTSW	9	42377907	missense	probably benign	0.44
R1239:Tecta	UTSW	9	42332485	missense	probably damaging	1.00
R1442:Tecta	UTSW	9	42332482	missense	probably damaging	1.00
R1553:Tecta	UTSW	9	42348186	missense	probably damaging	1.00
R1727:Tecta	UTSW	9	42359301	missense	probably damaging	0.96
R1728:Tecta	UTSW	9	42391922	missense	probably benign	0.12
R1729:Tecta	UTSW	9	42391922	missense	probably benign	0.12
R1762:Tecta	UTSW	9	42375309	missense	probably benign	0.30
R1778:Tecta	UTSW	9	42343631	missense	probably damaging	1.00
R1795:Tecta	UTSW	9	42378049	missense	probably benign
R1796:Tecta	UTSW	9	42384197	missense	probably damaging	1.00
R1866:Tecta	UTSW	9	42392024	missense	probably damaging	0.97
R1871:Tecta	UTSW	9	42337176	missense	probably damaging	0.98
R1871:Tecta	UTSW	9	42337340	missense	probably damaging	1.00
R1911:Tecta	UTSW	9	42337936	missense	probably damaging	1.00
R2074:Tecta	UTSW	9	42337279	nonsense	probably null
R2135:Tecta	UTSW	9	42340285	missense	probably damaging	1.00
R2171:Tecta	UTSW	9	42358924	missense	probably damaging	0.99
R2220:Tecta	UTSW	9	42392030	missense	probably damaging	1.00
R2372:Tecta	UTSW	9	42388274	missense	probably damaging	1.00
R2570:Tecta	UTSW	9	42332552	missense	probably damaging	1.00
R2939:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R2940:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R3081:Tecta	UTSW	9	42377994	missense	possibly damaging	0.63
R3407:Tecta	UTSW	9	42337854	missense	probably damaging	1.00
R3732:Tecta	UTSW	9	42392106	missense	possibly damaging	0.95
R3771:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3772:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3773:Tecta	UTSW	9	42330996	missense	probably damaging	1.00
R3832:Tecta	UTSW	9	42339033	missense	probably damaging	1.00
R4378:Tecta	UTSW	9	42366708	missense	probably damaging	1.00
R4480:Tecta	UTSW	9	42373233	missense	possibly damaging	0.75
R4485:Tecta	UTSW	9	42337274	missense	possibly damaging	0.73
R4804:Tecta	UTSW	9	42398237	missense	probably benign
R4869:Tecta	UTSW	9	42375534	missense	probably benign	0.02
R4944:Tecta	UTSW	9	42330277	missense	probably benign	0.05
R5008:Tecta	UTSW	9	42373062	missense	possibly damaging	0.76
R5014:Tecta	UTSW	9	42373242	missense	probably damaging	1.00
R5125:Tecta	UTSW	9	42375185	missense	probably damaging	1.00
R5178:Tecta	UTSW	9	42375185	missense	probably damaging	1.00
R5180:Tecta	UTSW	9	42337208	missense	probably damaging	1.00
R5214:Tecta	UTSW	9	42345668	missense	probably benign	0.04
R5230:Tecta	UTSW	9	42394943	missense	probably damaging	0.96
R5330:Tecta	UTSW	9	42337856	missense	probably damaging	1.00
R5614:Tecta	UTSW	9	42339055	missense	probably damaging	1.00
R5708:Tecta	UTSW	9	42338926	missense	probably damaging	1.00
R5738:Tecta	UTSW	9	42373178	missense	possibly damaging	0.63
R5770:Tecta	UTSW	9	42345589	missense	possibly damaging	0.94
R5839:Tecta	UTSW	9	42331023	missense	probably benign	0.03
R5839:Tecta	UTSW	9	42372976	missense	possibly damaging	0.86
R6119:Tecta	UTSW	9	42373075	missense	probably benign	0.00
R6246:Tecta	UTSW	9	42377908	missense	probably benign	0.07
R6377:Tecta	UTSW	9	42343755	missense	probably damaging	1.00
R6416:Tecta	UTSW	9	42375267	missense	probably damaging	0.97
R6595:Tecta	UTSW	9	42384227	missense	probably damaging	1.00
R6850:Tecta	UTSW	9	42343838	missense	probably benign	0.20
R6859:Tecta	UTSW	9	42392129	missense	probably damaging	1.00
R6861:Tecta	UTSW	9	42337337	missense	possibly damaging	0.93
R6939:Tecta	UTSW	9	42347997	missense	probably damaging	1.00
R6996:Tecta	UTSW	9	42366786	missense	probably benign
R7069:Tecta	UTSW	9	42394941	missense	probably benign	0.03
R7104:Tecta	UTSW	9	42366943	missense	probably benign	0.00
R7129:Tecta	UTSW	9	42347991	missense	probably damaging	1.00
R7220:Tecta	UTSW	9	42343887	missense	probably benign	0.05
R7251:Tecta	UTSW	9	42387752	missense	probably damaging	1.00
R7307:Tecta	UTSW	9	42377992	missense	probably damaging	1.00
R7343:Tecta	UTSW	9	42337332	missense	probably damaging	1.00
R7355:Tecta	UTSW	9	42367142	nonsense	probably null
R7635:Tecta	UTSW	9	42330987	missense	probably benign	0.11
R7653:Tecta	UTSW	9	42337236	missense	probably damaging	1.00
R7723:Tecta	UTSW	9	42366936	missense	probably damaging	1.00
R7939:Tecta	UTSW	9	42388223	missense	probably damaging	0.99
R7966:Tecta	UTSW	9	42394962	missense	probably damaging	0.98
R7967:Tecta	UTSW	9	42377955	missense	possibly damaging	0.95
R8000:Tecta	UTSW	9	42367184	nonsense	probably null
R8064:Tecta	UTSW	9	42394955	missense	possibly damaging	0.94
R8117:Tecta	UTSW	9	42377631	missense	probably damaging	1.00
R8176:Tecta	UTSW	9	42359169	missense	probably damaging	0.97
R8284:Tecta	UTSW	9	42378029	missense	possibly damaging	0.89
R8315:Tecta	UTSW	9	42387825	critical splice acceptor site	probably null
R8321:Tecta	UTSW	9	42373053	missense	probably damaging	1.00
R8332:Tecta	UTSW	9	42375014	missense	probably damaging	1.00
R8437:Tecta	UTSW	9	42332560	missense	probably damaging	0.98
R8496:Tecta	UTSW	9	42330251	missense	probably benign	0.01
R8514:Tecta	UTSW	9	42373110	missense	probably damaging	0.99
R8683:Tecta	UTSW	9	42366972	missense	probably damaging	0.96
R8856:Tecta	UTSW	9	42373301	missense	probably benign	0.13
R8886:Tecta	UTSW	9	42367063	missense	probably benign	0.37
R9047:Tecta	UTSW	9	42375079	missense	probably benign	0.00
R9106:Tecta	UTSW	9	42367183	missense	probably benign	0.05
R9332:Tecta	UTSW	9	42372897	missense	probably damaging	1.00
R9352:Tecta	UTSW	9	42337851	missense	probably damaging	1.00
R9462:Tecta	UTSW	9	42337280	missense	probably damaging	1.00
Z1176:Tecta	UTSW	9	42392094	missense	probably damaging	0.99
Z1177:Tecta	UTSW	9	42375576	missense	probably benign	0.00
Z1177:Tecta	UTSW	9	42392070	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGATCCATGTCCTCTTTAAGAATC -3'
(R):5'- TGCTTCAACAAGACCTGCCG -3'

Sequencing Primer
(F):5'- GTCCTCTTTAAGAATCAACTCCCAG -3'
(R):5'- TCAACAAGACCTGCCGGAGTG -3'

Posted On

2016-08-04