Mutagenetix > Incidental Mutation

Incidental Mutation 'R5387:Usp15'

425345

Institutional Source

Beutler Lab

Gene Symbol

Usp15

Ensembl Gene

ENSMUSG00000020124

Gene Name

ubiquitin specific peptidase 15

Synonyms

Gcap18, 4921514G19Rik, E430033I05Rik

MMRRC Submission

042959-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5387 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123105006-123196995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123131286 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 405 (I405T)

Ref Sequence

ENSEMBL: ENSMUSP00000151244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020334] [ENSMUST00000220377]

AlphaFold

Q8R5H1

Predicted Effect

probably benign
Transcript: ENSMUST00000020334
AA Change: I376T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000020334
Gene: ENSMUSG00000020124
AA Change: I376T

Domain	Start	End	E-Value	Type
DUSP	23	121	1.5e-46	SMART
Pfam:Ubiquitin_3	135	222	3.7e-38	PFAM
low complexity region	242	262	N/A	INTRINSIC
Pfam:UCH	288	930	6.8e-86	PFAM
Pfam:UCH_1	289	506	1.1e-5	PFAM
Pfam:USP7_C2	460	608	2e-7	PFAM
Pfam:UCH_1	756	912	1.3e-11	PFAM
low complexity region	959	976	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218079

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219413

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219937

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219992

Predicted Effect

probably damaging
Transcript: ENSMUST00000220377
AA Change: I405T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

Meta Mutation Damage Score

0.2307

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the large ubiquitin specific protease (Usp) family of proteins. These proteins are known to cleave ubiquitin, and contain a conserved cysteine residue (Cys box) and two conserved histidine residues (His box) that are thought to form part of the active site of the protease. This protein has been shown to cleave both the ubiquitin-proline and the ubiquitin-methionine bonds in vitro. This protein is thought to regulate many cellular processes through its deubiquitination activity, including the transforming growth factor beta (TGF-beta) pathway. Cardiac-specific overexpression of the human ortholog of this gene in mice causes enlargement of the heart that is more pronounced in the atrium than in the ventricle. This gene has two pseudogenes on chromosome 14. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms.[provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele or ENU induced allele exhibit resistance to pathological neuroinflammation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	A	T	11: 51,685,974	D32E	probably benign	Het
2210408I21Rik	T	A	13: 77,259,973	S140T	probably benign	Het
Ahnak	T	C	19: 9,003,691	S780P	probably damaging	Het
Ankhd1	C	A	18: 36,634,644	H1205N	probably damaging	Het
Ano1	T	C	7: 144,648,619	K139R	probably benign	Het
Anp32b	T	G	4: 46,468,573	C114W	probably damaging	Het
Ascl1	C	T	10: 87,492,689	A134T	probably damaging	Het
Atl2	C	T	17: 79,852,800	E453K	probably benign	Het
Aup1	C	T	6: 83,055,024	A84V	probably damaging	Het
Btbd7	A	T	12: 102,837,785	M332K	probably damaging	Het
Cacna1d	A	G	14: 30,100,751	V1107A	probably damaging	Het
Cd33	G	A	7: 43,532,053	Q114*	probably null	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Defb22	C	A	2: 152,485,906	A120S	unknown	Het
Dnah7b	A	G	1: 46,188,659	I1347M	probably damaging	Het
Efcab5	A	G	11: 77,134,842	I549T	possibly damaging	Het
Esp15	T	A	17: 39,644,577		probably null	Het
Fbxo7	A	G	10: 86,024,654	T42A	probably benign	Het
Filip1	A	G	9: 79,818,274	I1021T	probably benign	Het
Gad1	C	A	2: 70,563,851	S7*	probably null	Het
Gm281	C	A	14: 13,914,438	M1I	probably null	Het
H2-Q7	C	T	17: 35,439,542	T52M	probably damaging	Het
H2-T3	C	T	17: 36,186,702	G28R	probably benign	Het
Hist1h2ad	T	A	13: 23,574,667		probably null	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ift81	A	G	5: 122,555,535	Y604H	probably damaging	Het
Igsf11	A	G	16: 39,022,423	Y154C	probably damaging	Het
Kif26b	G	T	1: 178,914,876	A846S	probably benign	Het
Lnx2	G	A	5: 147,028,154	P420S	probably benign	Het
Lrit2	A	G	14: 37,072,259	T427A	probably damaging	Het
Lrrc43	G	T	5: 123,499,671		probably null	Het
Mug1	T	C	6: 121,884,394	Y1325H	probably damaging	Het
Naglu	A	T	11: 101,076,724	Y500F	probably damaging	Het
Npy4r	A	G	14: 34,146,983	M116T	probably benign	Het
Nrd1	A	G	4: 109,039,762	Y526C	probably damaging	Het
Nrp2	T	C	1: 62,762,813	S472P	probably benign	Het
Olfr102	T	A	17: 37,314,292	T31S	probably benign	Het
Olfr361	T	C	2: 37,085,719	T10A	possibly damaging	Het
Otogl	T	A	10: 107,780,933	T1828S	probably benign	Het
Pank2	C	T	2: 131,274,262	T200I	probably benign	Het
Pbrm1	A	G	14: 31,082,610	Y946C	probably damaging	Het
Pde12	A	T	14: 26,666,453	S437T	probably benign	Het
Pikfyve	A	G	1: 65,265,268	K1710E	possibly damaging	Het
Plcd3	A	G	11: 103,078,455	S229P	probably damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Prkaa2	C	A	4: 105,040,177	D280Y	probably damaging	Het
Ptprg	T	A	14: 12,153,873	S531R	probably damaging	Het
R3hdm2	T	C	10: 127,485,434	S620P	probably damaging	Het
Rab33b	A	G	3: 51,493,455	T117A	probably damaging	Het
Rasal2	T	C	1: 157,157,765	D804G	possibly damaging	Het
Rbp3	A	G	14: 33,956,413	T773A	possibly damaging	Het
Rrnad1	A	T	3: 87,930,011		probably benign	Het
Rspry1	A	G	8: 94,638,286	T185A	possibly damaging	Het
Sec61a2	G	T	2: 5,882,545		probably benign	Het
Setx	C	T	2: 29,147,594	R1364C	probably benign	Het
Shtn1	G	T	19: 59,038,369	L97M	probably damaging	Het
Slc35f1	T	C	10: 53,108,164	L340P	probably damaging	Het
Slc45a1	T	A	4: 150,643,909		probably benign	Het
Slmap	T	C	14: 26,459,933	E386G	probably benign	Het
Smc2	C	T	4: 52,475,096	A924V	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Tecta	G	A	9: 42,375,063	L766F	probably damaging	Het
Tle3	C	T	9: 61,407,489		probably null	Het
Top3a	A	G	11: 60,762,490	F53L	probably damaging	Het
Trem1	T	C	17: 48,241,513	I26T	possibly damaging	Het
Ttc7b	G	T	12: 100,446,963	Q199K	possibly damaging	Het
Ubap2l	T	C	3: 90,006,596	Y975C	probably benign	Het
Ubxn11	C	A	4: 134,123,426	D196E	probably damaging	Het
Unc80	A	G	1: 66,530,021	H945R	possibly damaging	Het
Uty	C	T	Y: 1,189,339	E138K	probably damaging	Het
Wapl	A	G	14: 34,677,295	E107G	probably benign	Het
Wbp1l	T	C	19: 46,644,457		probably null	Het
Zfp184	T	G	13: 21,949,640		probably benign	Het
Zfp36	A	C	7: 28,377,868	L205R	possibly damaging	Het

Other mutations in Usp15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Usp15	APN	10	123113596	missense	probably benign	0.00
IGL02148:Usp15	APN	10	123127837	missense	probably damaging	1.00
IGL02737:Usp15	APN	10	123131032	missense	probably damaging	1.00
IGL03054:Usp15	APN	10	123125931	splice site	probably benign
IGL03163:Usp15	APN	10	123171144	missense	probably damaging	0.96
R1755:Usp15	UTSW	10	123133044	missense	probably damaging	0.98
R1981:Usp15	UTSW	10	123125041	splice site	probably benign
R2049:Usp15	UTSW	10	123119137	missense	probably damaging	1.00
R3037:Usp15	UTSW	10	123163617	missense	probably damaging	1.00
R3698:Usp15	UTSW	10	123181738	missense	probably damaging	1.00
R3828:Usp15	UTSW	10	123196870	missense	possibly damaging	0.95
R3845:Usp15	UTSW	10	123119135	missense	probably damaging	1.00
R4838:Usp15	UTSW	10	123127757	missense	probably damaging	0.99
R4954:Usp15	UTSW	10	123131398	missense	probably damaging	1.00
R5204:Usp15	UTSW	10	123113640	missense	probably benign	0.06
R5274:Usp15	UTSW	10	123168351	missense	probably damaging	1.00
R5474:Usp15	UTSW	10	123128045	missense	probably damaging	1.00
R5501:Usp15	UTSW	10	123175899	missense	probably damaging	0.99
R5665:Usp15	UTSW	10	123130987	nonsense	probably null
R5846:Usp15	UTSW	10	123181742	missense	probably damaging	1.00
R5850:Usp15	UTSW	10	123124512	critical splice donor site	probably null
R6163:Usp15	UTSW	10	123168305	missense	probably damaging	1.00
R6735:Usp15	UTSW	10	123168367	missense	possibly damaging	0.86
R6828:Usp15	UTSW	10	123127989	missense	probably damaging	1.00
R7170:Usp15	UTSW	10	123171195	missense	probably damaging	1.00
R7197:Usp15	UTSW	10	123131005	missense	possibly damaging	0.92
R7351:Usp15	UTSW	10	123132999	missense	probably damaging	1.00
R7368:Usp15	UTSW	10	123196893	missense	possibly damaging	0.86
R7447:Usp15	UTSW	10	123175881	missense	probably damaging	1.00
R8099:Usp15	UTSW	10	123146921	missense	possibly damaging	0.87
R8169:Usp15	UTSW	10	123125893	missense
R8316:Usp15	UTSW	10	123123943	missense
R8795:Usp15	UTSW	10	123153048	missense	probably benign	0.00
R9005:Usp15	UTSW	10	123146798	missense	possibly damaging	0.89
R9023:Usp15	UTSW	10	123125593	missense	possibly damaging	0.85
R9156:Usp15	UTSW	10	123113648	missense	probably benign	0.13
R9198:Usp15	UTSW	10	123168238	missense	probably damaging	1.00
R9278:Usp15	UTSW	10	123171207	missense	probably damaging	0.96
R9592:Usp15	UTSW	10	123163617	missense	probably damaging	1.00
Z1176:Usp15	UTSW	10	123196961	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- CGTAGACTTGAAAAGGCCATGG -3'
(R):5'- TAAACTGAGAGCAAGCATGTGC -3'

Sequencing Primer
(F):5'- GCCATGGAATATGTCTACTATGATGG -3'
(R):5'- CATGTGCTTTTTCAGGAGCC -3'

Posted On

2016-08-04