Mutagenetix > Incidental Mutation

Incidental Mutation 'R5387:Plcd3'

425352

Institutional Source

Beutler Lab

Gene Symbol

Plcd3

Ensembl Gene

ENSMUSG00000020937

Gene Name

phospholipase C, delta 3

Synonyms

2610205J15Rik

MMRRC Submission

042959-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.669) question?

Stock #

R5387 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103070304-103101658 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103078455 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 229 (S229P)

Ref Sequence

ENSEMBL: ENSMUSP00000099366 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103077]

AlphaFold

Q8K2J0

Predicted Effect

probably damaging
Transcript: ENSMUST00000103077
AA Change: S229P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099366
Gene: ENSMUSG00000020937
AA Change: S229P

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	23	38	N/A	INTRINSIC
PH	61	170	4.07e-5	SMART
Pfam:EF-hand_10	197	246	1.8e-27	PFAM
Pfam:EF-hand_like	251	332	2.6e-24	PFAM
PLCXc	333	478	7.75e-85	SMART
low complexity region	495	512	N/A	INTRINSIC
PLCYc	524	640	3.96e-50	SMART
C2	657	763	1.05e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128650

SMART Domains

Protein: ENSMUSP00000117455
Gene: ENSMUSG00000020937

Domain	Start	End	E-Value	Type
low complexity region	8	18	N/A	INTRINSIC
PLCXc	19	164	7.75e-85	SMART
coiled coil region	172	206	N/A	INTRINSIC
PLCYc	210	326	3.96e-50	SMART
C2	343	449	1.05e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142970

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143012

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181125

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase C family, which catalyze the hydrolysis of phosphatidylinositol 4,5-bisphosphate to generate the second messengers diacylglycerol and inositol 1,4,5-trisphosphate (IP3). Diacylglycerol and IP3 mediate a variety of cellular responses to extracellular stimuli by inducing protein kinase C and increasing cytosolic Ca(2+) concentrations. This enzyme localizes to the plasma membrane and requires calcium for activation. Its activity is inhibited by spermine, sphingosine, and several phospholipids. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	A	T	11: 51,685,974	D32E	probably benign	Het
2210408I21Rik	T	A	13: 77,259,973	S140T	probably benign	Het
Ahnak	T	C	19: 9,003,691	S780P	probably damaging	Het
Ankhd1	C	A	18: 36,634,644	H1205N	probably damaging	Het
Ano1	T	C	7: 144,648,619	K139R	probably benign	Het
Anp32b	T	G	4: 46,468,573	C114W	probably damaging	Het
Ascl1	C	T	10: 87,492,689	A134T	probably damaging	Het
Atl2	C	T	17: 79,852,800	E453K	probably benign	Het
Aup1	C	T	6: 83,055,024	A84V	probably damaging	Het
Btbd7	A	T	12: 102,837,785	M332K	probably damaging	Het
Cacna1d	A	G	14: 30,100,751	V1107A	probably damaging	Het
Cd33	G	A	7: 43,532,053	Q114*	probably null	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Defb22	C	A	2: 152,485,906	A120S	unknown	Het
Dnah7b	A	G	1: 46,188,659	I1347M	probably damaging	Het
Efcab5	A	G	11: 77,134,842	I549T	possibly damaging	Het
Esp15	T	A	17: 39,644,577		probably null	Het
Fbxo7	A	G	10: 86,024,654	T42A	probably benign	Het
Filip1	A	G	9: 79,818,274	I1021T	probably benign	Het
Gad1	C	A	2: 70,563,851	S7*	probably null	Het
Gm281	C	A	14: 13,914,438	M1I	probably null	Het
H2-Q7	C	T	17: 35,439,542	T52M	probably damaging	Het
H2-T3	C	T	17: 36,186,702	G28R	probably benign	Het
Hist1h2ad	T	A	13: 23,574,667		probably null	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ift81	A	G	5: 122,555,535	Y604H	probably damaging	Het
Igsf11	A	G	16: 39,022,423	Y154C	probably damaging	Het
Kif26b	G	T	1: 178,914,876	A846S	probably benign	Het
Lnx2	G	A	5: 147,028,154	P420S	probably benign	Het
Lrit2	A	G	14: 37,072,259	T427A	probably damaging	Het
Lrrc43	G	T	5: 123,499,671		probably null	Het
Mug1	T	C	6: 121,884,394	Y1325H	probably damaging	Het
Naglu	A	T	11: 101,076,724	Y500F	probably damaging	Het
Npy4r	A	G	14: 34,146,983	M116T	probably benign	Het
Nrd1	A	G	4: 109,039,762	Y526C	probably damaging	Het
Nrp2	T	C	1: 62,762,813	S472P	probably benign	Het
Olfr102	T	A	17: 37,314,292	T31S	probably benign	Het
Olfr361	T	C	2: 37,085,719	T10A	possibly damaging	Het
Otogl	T	A	10: 107,780,933	T1828S	probably benign	Het
Pank2	C	T	2: 131,274,262	T200I	probably benign	Het
Pbrm1	A	G	14: 31,082,610	Y946C	probably damaging	Het
Pde12	A	T	14: 26,666,453	S437T	probably benign	Het
Pikfyve	A	G	1: 65,265,268	K1710E	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Prkaa2	C	A	4: 105,040,177	D280Y	probably damaging	Het
Ptprg	T	A	14: 12,153,873	S531R	probably damaging	Het
R3hdm2	T	C	10: 127,485,434	S620P	probably damaging	Het
Rab33b	A	G	3: 51,493,455	T117A	probably damaging	Het
Rasal2	T	C	1: 157,157,765	D804G	possibly damaging	Het
Rbp3	A	G	14: 33,956,413	T773A	possibly damaging	Het
Rrnad1	A	T	3: 87,930,011		probably benign	Het
Rspry1	A	G	8: 94,638,286	T185A	possibly damaging	Het
Sec61a2	G	T	2: 5,882,545		probably benign	Het
Setx	C	T	2: 29,147,594	R1364C	probably benign	Het
Shtn1	G	T	19: 59,038,369	L97M	probably damaging	Het
Slc35f1	T	C	10: 53,108,164	L340P	probably damaging	Het
Slc45a1	T	A	4: 150,643,909		probably benign	Het
Slmap	T	C	14: 26,459,933	E386G	probably benign	Het
Smc2	C	T	4: 52,475,096	A924V	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Tecta	G	A	9: 42,375,063	L766F	probably damaging	Het
Tle3	C	T	9: 61,407,489		probably null	Het
Top3a	A	G	11: 60,762,490	F53L	probably damaging	Het
Trem1	T	C	17: 48,241,513	I26T	possibly damaging	Het
Ttc7b	G	T	12: 100,446,963	Q199K	possibly damaging	Het
Ubap2l	T	C	3: 90,006,596	Y975C	probably benign	Het
Ubxn11	C	A	4: 134,123,426	D196E	probably damaging	Het
Unc80	A	G	1: 66,530,021	H945R	possibly damaging	Het
Usp15	A	G	10: 123,131,286	I405T	probably damaging	Het
Uty	C	T	Y: 1,189,339	E138K	probably damaging	Het
Wapl	A	G	14: 34,677,295	E107G	probably benign	Het
Wbp1l	T	C	19: 46,644,457		probably null	Het
Zfp184	T	G	13: 21,949,640		probably benign	Het
Zfp36	A	C	7: 28,377,868	L205R	possibly damaging	Het

Other mutations in Plcd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01285:Plcd3	APN	11	103077870	missense	probably benign	0.16
IGL01906:Plcd3	APN	11	103076856	missense	probably damaging	1.00
IGL02325:Plcd3	APN	11	103080621	nonsense	probably null
IGL02634:Plcd3	APN	11	103077827	missense	probably damaging	1.00
IGL02852:Plcd3	APN	11	103073805	missense	probably damaging	1.00
IGL03025:Plcd3	APN	11	103074898	missense	probably benign	0.24
IGL02837:Plcd3	UTSW	11	103071103	missense	possibly damaging	0.92
IGL02988:Plcd3	UTSW	11	103076742	missense	probably benign
R0055:Plcd3	UTSW	11	103077585	missense	probably damaging	1.00
R0055:Plcd3	UTSW	11	103077585	missense	probably damaging	1.00
R0062:Plcd3	UTSW	11	103074894	missense	probably benign
R0452:Plcd3	UTSW	11	103071259	unclassified	probably benign
R0529:Plcd3	UTSW	11	103080187	missense	probably benign	0.00
R0556:Plcd3	UTSW	11	103077806	missense	probably damaging	1.00
R1463:Plcd3	UTSW	11	103078373	missense	probably damaging	1.00
R1752:Plcd3	UTSW	11	103080259	missense	probably benign	0.01
R2157:Plcd3	UTSW	11	103071148	missense	probably benign
R2519:Plcd3	UTSW	11	103080400	missense	possibly damaging	0.80
R3809:Plcd3	UTSW	11	103101383	missense	probably null	0.03
R4167:Plcd3	UTSW	11	103078464	missense	probably damaging	0.98
R5100:Plcd3	UTSW	11	103078349	missense	probably benign
R5589:Plcd3	UTSW	11	103077803	missense	probably benign	0.01
R5700:Plcd3	UTSW	11	103073763	missense	probably benign	0.00
R5754:Plcd3	UTSW	11	103073766	missense	possibly damaging	0.67
R5936:Plcd3	UTSW	11	103078347	missense	probably damaging	1.00
R6059:Plcd3	UTSW	11	103080401	missense	possibly damaging	0.80
R6102:Plcd3	UTSW	11	103080644	missense	probably damaging	0.99
R6480:Plcd3	UTSW	11	103074931	missense	possibly damaging	0.79
R6481:Plcd3	UTSW	11	103077767	missense	probably damaging	1.00
R6566:Plcd3	UTSW	11	103073800	missense	probably damaging	1.00
R7098:Plcd3	UTSW	11	103077863	missense	probably damaging	1.00
R7165:Plcd3	UTSW	11	103079613	missense	probably damaging	1.00
R7392:Plcd3	UTSW	11	103101557	unclassified	probably benign
R7484:Plcd3	UTSW	11	103071719	missense	probably damaging	1.00
R7606:Plcd3	UTSW	11	103076857	missense	probably damaging	1.00
R7777:Plcd3	UTSW	11	103074655	missense	probably benign	0.33
R7857:Plcd3	UTSW	11	103077934	missense	probably benign	0.12
R8349:Plcd3	UTSW	11	103074670	missense	probably damaging	1.00
R8449:Plcd3	UTSW	11	103074670	missense	probably damaging	1.00
R8786:Plcd3	UTSW	11	103071743	missense	probably damaging	1.00
R8848:Plcd3	UTSW	11	103080620	missense	probably benign	0.00
R8894:Plcd3	UTSW	11	103071766	missense	probably damaging	1.00
R8983:Plcd3	UTSW	11	103071266	missense	possibly damaging	0.73
R9252:Plcd3	UTSW	11	103077554	nonsense	probably null
R9253:Plcd3	UTSW	11	103079634	missense	probably benign	0.05
X0023:Plcd3	UTSW	11	103080208	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAAGTCTGGATAAGCTGCTGG -3'
(R):5'- TCCTGATCTTGATCCCTGGGAC -3'

Sequencing Primer
(F):5'- TAAGCTGCTGGGCACAGG -3'
(R):5'- TGGGACAGTTGAGGACTCC -3'

Posted On

2016-08-04