Incidental Mutation 'R5387:Rbp3'
ID 425365
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Name retinol binding protein 3, interstitial
Synonyms Rbp-3, Irbp
MMRRC Submission 042959-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.100) question?
Stock # R5387 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 33954003-33964216 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33956413 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 773 (T773A)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000035695
AA Change: T773A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: T773A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Meta Mutation Damage Score 0.0943 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,685,974 D32E probably benign Het
2210408I21Rik T A 13: 77,259,973 S140T probably benign Het
Ahnak T C 19: 9,003,691 S780P probably damaging Het
Ankhd1 C A 18: 36,634,644 H1205N probably damaging Het
Ano1 T C 7: 144,648,619 K139R probably benign Het
Anp32b T G 4: 46,468,573 C114W probably damaging Het
Ascl1 C T 10: 87,492,689 A134T probably damaging Het
Atl2 C T 17: 79,852,800 E453K probably benign Het
Aup1 C T 6: 83,055,024 A84V probably damaging Het
Btbd7 A T 12: 102,837,785 M332K probably damaging Het
Cacna1d A G 14: 30,100,751 V1107A probably damaging Het
Cd33 G A 7: 43,532,053 Q114* probably null Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Defb22 C A 2: 152,485,906 A120S unknown Het
Dnah7b A G 1: 46,188,659 I1347M probably damaging Het
Efcab5 A G 11: 77,134,842 I549T possibly damaging Het
Esp15 T A 17: 39,644,577 probably null Het
Fbxo7 A G 10: 86,024,654 T42A probably benign Het
Filip1 A G 9: 79,818,274 I1021T probably benign Het
Gad1 C A 2: 70,563,851 S7* probably null Het
Gm281 C A 14: 13,914,438 M1I probably null Het
H2-Q7 C T 17: 35,439,542 T52M probably damaging Het
H2-T3 C T 17: 36,186,702 G28R probably benign Het
Hist1h2ad T A 13: 23,574,667 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift81 A G 5: 122,555,535 Y604H probably damaging Het
Igsf11 A G 16: 39,022,423 Y154C probably damaging Het
Kif26b G T 1: 178,914,876 A846S probably benign Het
Lnx2 G A 5: 147,028,154 P420S probably benign Het
Lrit2 A G 14: 37,072,259 T427A probably damaging Het
Lrrc43 G T 5: 123,499,671 probably null Het
Mug1 T C 6: 121,884,394 Y1325H probably damaging Het
Naglu A T 11: 101,076,724 Y500F probably damaging Het
Npy4r A G 14: 34,146,983 M116T probably benign Het
Nrd1 A G 4: 109,039,762 Y526C probably damaging Het
Nrp2 T C 1: 62,762,813 S472P probably benign Het
Olfr102 T A 17: 37,314,292 T31S probably benign Het
Olfr361 T C 2: 37,085,719 T10A possibly damaging Het
Otogl T A 10: 107,780,933 T1828S probably benign Het
Pank2 C T 2: 131,274,262 T200I probably benign Het
Pbrm1 A G 14: 31,082,610 Y946C probably damaging Het
Pde12 A T 14: 26,666,453 S437T probably benign Het
Pikfyve A G 1: 65,265,268 K1710E possibly damaging Het
Plcd3 A G 11: 103,078,455 S229P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkaa2 C A 4: 105,040,177 D280Y probably damaging Het
Ptprg T A 14: 12,153,873 S531R probably damaging Het
R3hdm2 T C 10: 127,485,434 S620P probably damaging Het
Rab33b A G 3: 51,493,455 T117A probably damaging Het
Rasal2 T C 1: 157,157,765 D804G possibly damaging Het
Rrnad1 A T 3: 87,930,011 probably benign Het
Rspry1 A G 8: 94,638,286 T185A possibly damaging Het
Sec61a2 G T 2: 5,882,545 probably benign Het
Setx C T 2: 29,147,594 R1364C probably benign Het
Shtn1 G T 19: 59,038,369 L97M probably damaging Het
Slc35f1 T C 10: 53,108,164 L340P probably damaging Het
Slc45a1 T A 4: 150,643,909 probably benign Het
Slmap T C 14: 26,459,933 E386G probably benign Het
Smc2 C T 4: 52,475,096 A924V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Tecta G A 9: 42,375,063 L766F probably damaging Het
Tle3 C T 9: 61,407,489 probably null Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Trem1 T C 17: 48,241,513 I26T possibly damaging Het
Ttc7b G T 12: 100,446,963 Q199K possibly damaging Het
Ubap2l T C 3: 90,006,596 Y975C probably benign Het
Ubxn11 C A 4: 134,123,426 D196E probably damaging Het
Unc80 A G 1: 66,530,021 H945R possibly damaging Het
Usp15 A G 10: 123,131,286 I405T probably damaging Het
Uty C T Y: 1,189,339 E138K probably damaging Het
Wapl A G 14: 34,677,295 E107G probably benign Het
Wbp1l T C 19: 46,644,457 probably null Het
Zfp184 T G 13: 21,949,640 probably benign Het
Zfp36 A C 7: 28,377,868 L205R possibly damaging Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
Behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
Rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33955840 missense probably benign
R7756:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7758:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7784:Rbp3 UTSW 14 33954158 missense probably benign 0.41
R7845:Rbp3 UTSW 14 33956464 missense probably benign 0.24
R8176:Rbp3 UTSW 14 33955648 missense possibly damaging 0.67
R8281:Rbp3 UTSW 14 33956363 missense probably benign 0.00
R8393:Rbp3 UTSW 14 33956199 missense possibly damaging 0.93
R8552:Rbp3 UTSW 14 33955664 missense probably benign 0.01
R8717:Rbp3 UTSW 14 33956438 missense probably damaging 0.99
R8730:Rbp3 UTSW 14 33955838 missense probably benign
R8773:Rbp3 UTSW 14 33962535 missense possibly damaging 0.71
R8836:Rbp3 UTSW 14 33958631 missense possibly damaging 0.95
R8843:Rbp3 UTSW 14 33954565 missense probably benign
R8880:Rbp3 UTSW 14 33956839 missense probably benign 0.16
R8941:Rbp3 UTSW 14 33956529 missense possibly damaging 0.92
R8971:Rbp3 UTSW 14 33955835 missense probably damaging 1.00
R8998:Rbp3 UTSW 14 33962403 nonsense probably null
R8999:Rbp3 UTSW 14 33962403 nonsense probably null
R9436:Rbp3 UTSW 14 33955277 missense possibly damaging 0.94
R9525:Rbp3 UTSW 14 33954445 missense probably benign 0.00
R9563:Rbp3 UTSW 14 33955520 missense probably damaging 1.00
R9564:Rbp3 UTSW 14 33955520 missense probably damaging 1.00
R9723:Rbp3 UTSW 14 33955517 missense possibly damaging 0.92
Z1177:Rbp3 UTSW 14 33954538 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TATTCCATAGCCCTGGGGAG -3'
(R):5'- ATGGGATCCATAGCGTTGC -3'

Sequencing Primer
(F):5'- CATAGCCCTGGGGAGCTTGTG -3'
(R):5'- ATCCATAGCGTTGCCCAGC -3'
Posted On 2016-08-04