Incidental Mutation 'R5388:Yme1l1'
ID425388
Institutional Source Beutler Lab
Gene Symbol Yme1l1
Ensembl Gene ENSMUSG00000026775
Gene NameYME1-like 1 (S. cerevisiae)
SynonymsATP-dependent metalloprotease FtsH1, Ftsh
MMRRC Submission 042960-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5388 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location23156369-23199260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 23162557 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 74 (D74E)
Ref Sequence ENSEMBL: ENSMUSP00000028117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028117]
Predicted Effect probably benign
Transcript: ENSMUST00000028117
AA Change: D74E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028117
Gene: ENSMUSG00000026775
AA Change: D74E

DomainStartEndE-ValueType
AAA 313 450 4.77e-23 SMART
Pfam:Peptidase_M41 508 706 5.8e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149240
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the human ortholog of yeast mitochondrial AAA metalloprotease, Yme1p. It is localized in the mitochondria and can functionally complement a yme1 disruptant yeast strain. It is proposed that this gene plays a role in mitochondrial protein metabolism and could be involved in mitochondrial pathologies. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null embryos die prior to E13.5, and show a developmental delay from E8.5 to E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,727 Q4483R probably damaging Het
Abca16 T C 7: 120,540,746 probably null Het
Acap2 C A 16: 31,109,725 C475F probably damaging Het
Ace C A 11: 105,988,458 P603Q possibly damaging Het
Adamts20 C G 15: 94,345,778 V657L possibly damaging Het
Antxr2 A G 5: 97,977,599 probably null Het
Atp6v1b2 G A 8: 69,101,437 V89I probably benign Het
Cacna1e G A 1: 154,477,796 P676L probably damaging Het
Camsap3 A T 8: 3,604,276 I649F probably damaging Het
Camta1 G T 4: 151,075,238 S490R probably damaging Het
Celsr1 A G 15: 85,925,518 I2221T probably damaging Het
Cfd A T 10: 79,892,125 D164V probably damaging Het
Cfdp1 T C 8: 111,768,752 D278G probably damaging Het
Cntn6 A T 6: 104,832,562 L519F probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Cybrd1 T C 2: 71,137,645 probably null Het
Cyp2e1 T C 7: 140,763,993 L48P probably damaging Het
Ep400 G A 5: 110,701,728 T1409I unknown Het
Epp13 T C 7: 6,266,347 probably null Het
Exosc7 A T 9: 123,118,907 D47V probably damaging Het
Fgr T C 4: 132,995,031 F204L probably damaging Het
Gm10100 G A 10: 77,726,726 V81M probably benign Het
Gm12367 T C 4: 35,235,690 noncoding transcript Het
Gm15922 T C 7: 3,738,857 T175A possibly damaging Het
Grxcr1 C A 5: 68,166,195 T272K probably damaging Het
Kcna5 C T 6: 126,534,896 D90N probably benign Het
Kdm5b T A 1: 134,608,897 Y618* probably null Het
Lama5 T A 2: 180,190,746 H1670L possibly damaging Het
Mtus2 C T 5: 148,306,708 Q113* probably null Het
Ncam1 A C 9: 49,544,754 D521E probably benign Het
Nkapl T C 13: 21,467,570 H291R possibly damaging Het
Nlrp1b T G 11: 71,172,141 N695H probably damaging Het
Npc1l1 T A 11: 6,214,733 Q1105H probably damaging Het
Paxip1 C G 5: 27,781,455 probably benign Het
Pign A T 1: 105,655,970 W136R probably damaging Het
Pkn3 T A 2: 30,081,074 S222T probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppfibp1 T A 6: 146,996,840 I98N probably damaging Het
Ppfibp1 T G 6: 147,016,330 S484A probably damaging Het
Ppp1r7 T C 1: 93,352,590 F127L probably damaging Het
Pramel1 T C 4: 143,397,384 Y210H probably benign Het
Rad21l C T 2: 151,653,483 V427I probably benign Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rnf225 A G 7: 12,928,005 D37G probably damaging Het
Smpd2 A G 10: 41,487,971 probably null Het
Tmem38b C T 4: 53,859,945 R242W probably benign Het
Topaz1 A T 9: 122,774,093 K1035I possibly damaging Het
Trhr T C 15: 44,197,477 I131T possibly damaging Het
Usp1 A G 4: 98,931,057 D252G probably benign Het
Usp14 C T 18: 10,018,023 E90K probably damaging Het
Ythdc2 T A 18: 44,857,025 L732Q possibly damaging Het
Zbbx G T 3: 75,083,670 A289D probably damaging Het
Zfhx3 G A 8: 108,946,814 V1499I possibly damaging Het
Zfp622 T C 15: 25,996,199 V184A possibly damaging Het
Other mutations in Yme1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Yme1l1 APN 2 23192500 missense probably benign 0.00
IGL01764:Yme1l1 APN 2 23162544 missense probably benign 0.00
IGL03289:Yme1l1 APN 2 23160268 missense probably benign
R0043:Yme1l1 UTSW 2 23187803 missense probably damaging 0.97
R0540:Yme1l1 UTSW 2 23192515 missense possibly damaging 0.68
R0583:Yme1l1 UTSW 2 23186250 missense probably damaging 1.00
R0661:Yme1l1 UTSW 2 23191042 missense probably damaging 0.96
R0673:Yme1l1 UTSW 2 23168288 missense probably benign 0.03
R2154:Yme1l1 UTSW 2 23162508 missense probably damaging 0.99
R2241:Yme1l1 UTSW 2 23196900 nonsense probably null
R2270:Yme1l1 UTSW 2 23175220 missense possibly damaging 0.53
R2345:Yme1l1 UTSW 2 23194786 missense probably damaging 1.00
R3837:Yme1l1 UTSW 2 23191080 missense possibly damaging 0.69
R4344:Yme1l1 UTSW 2 23173061 missense probably benign 0.02
R4368:Yme1l1 UTSW 2 23160211 missense possibly damaging 0.81
R4412:Yme1l1 UTSW 2 23175187 missense probably damaging 1.00
R4470:Yme1l1 UTSW 2 23186332 critical splice donor site probably null
R4472:Yme1l1 UTSW 2 23186332 critical splice donor site probably null
R4934:Yme1l1 UTSW 2 23168321 nonsense probably null
R5033:Yme1l1 UTSW 2 23194747 missense probably damaging 1.00
R5389:Yme1l1 UTSW 2 23193234 missense probably damaging 1.00
R5943:Yme1l1 UTSW 2 23168330 missense probably damaging 0.96
R5947:Yme1l1 UTSW 2 23195306 intron probably benign
R6243:Yme1l1 UTSW 2 23193172 missense probably benign 0.00
R6724:Yme1l1 UTSW 2 23194762 missense probably damaging 1.00
R6891:Yme1l1 UTSW 2 23195389 missense probably damaging 0.99
R7016:Yme1l1 UTSW 2 23186355 intron probably null
R7565:Yme1l1 UTSW 2 23160220 missense possibly damaging 0.88
R7589:Yme1l1 UTSW 2 23160262 missense probably benign 0.01
R7751:Yme1l1 UTSW 2 23187844 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGGTTAGTCAAATGTCATGAC -3'
(R):5'- GAACTGGCCCATAGTAAATGCAC -3'

Sequencing Primer
(F):5'- GTCATGACTAACCTTAGTAAAACTGG -3'
(R):5'- GGCCCATAGTAAATGCACACACTAC -3'
Posted On2016-08-04