Incidental Mutation 'R5388:Camta1'
ID425400
Institutional Source Beutler Lab
Gene Symbol Camta1
Ensembl Gene ENSMUSG00000014592
Gene Namecalmodulin binding transcription activator 1
Synonyms1810059M14Rik, 2310058O09Rik
MMRRC Submission 042960-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.592) question?
Stock #R5388 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location150917322-151861876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 151075238 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 490 (S490R)
Ref Sequence ENSEMBL: ENSMUSP00000101295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049790] [ENSMUST00000097774] [ENSMUST00000105668] [ENSMUST00000105670] [ENSMUST00000140030] [ENSMUST00000169423]
Predicted Effect probably damaging
Transcript: ENSMUST00000049790
AA Change: S1588R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054804
Gene: ENSMUSG00000014592
AA Change: S1588R

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3e-13 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097774
AA Change: S1581R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095381
Gene: ENSMUSG00000014592
AA Change: S1581R

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1570 5.45e1 SMART
IQ 1571 1593 5.42e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105668
AA Change: S497R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101293
Gene: ENSMUSG00000014592
AA Change: S497R

DomainStartEndE-ValueType
low complexity region 19 52 N/A INTRINSIC
ANK 88 117 1.7e2 SMART
ANK 133 163 4.73e2 SMART
Blast:ANK 167 197 6e-10 BLAST
IQ 457 473 2.38e2 SMART
IQ 487 509 5.42e0 SMART
Pfam:IQ 512 527 5.1e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105670
AA Change: S490R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101295
Gene: ENSMUSG00000014592
AA Change: S490R

DomainStartEndE-ValueType
low complexity region 19 52 N/A INTRINSIC
ANK 88 117 1.7e2 SMART
ANK 133 163 4.73e2 SMART
Blast:ANK 167 197 5e-10 BLAST
IQ 457 479 5.45e1 SMART
IQ 480 502 5.42e0 SMART
Pfam:IQ 505 520 5.1e-4 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140030
AA Change: S144R

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119067
Gene: ENSMUSG00000014592
AA Change: S144R

DomainStartEndE-ValueType
IQ 111 133 5.45e1 SMART
IQ 134 156 5.42e0 SMART
Pfam:IQ 159 174 8.5e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169423
AA Change: S1588R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592
AA Change: S1588R

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Meta Mutation Damage Score 0.3512 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Global or nervous system deletion of this gene results in decreased body size, severe ataxia, progressive Purkinje cell degeneration, and cerebellar atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,727 Q4483R probably damaging Het
Abca16 T C 7: 120,540,746 probably null Het
Acap2 C A 16: 31,109,725 C475F probably damaging Het
Ace C A 11: 105,988,458 P603Q possibly damaging Het
Adamts20 C G 15: 94,345,778 V657L possibly damaging Het
Antxr2 A G 5: 97,977,599 probably null Het
Atp6v1b2 G A 8: 69,101,437 V89I probably benign Het
Cacna1e G A 1: 154,477,796 P676L probably damaging Het
Camsap3 A T 8: 3,604,276 I649F probably damaging Het
Celsr1 A G 15: 85,925,518 I2221T probably damaging Het
Cfd A T 10: 79,892,125 D164V probably damaging Het
Cfdp1 T C 8: 111,768,752 D278G probably damaging Het
Cntn6 A T 6: 104,832,562 L519F probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Cybrd1 T C 2: 71,137,645 probably null Het
Cyp2e1 T C 7: 140,763,993 L48P probably damaging Het
Ep400 G A 5: 110,701,728 T1409I unknown Het
Epp13 T C 7: 6,266,347 probably null Het
Exosc7 A T 9: 123,118,907 D47V probably damaging Het
Fgr T C 4: 132,995,031 F204L probably damaging Het
Gm10100 G A 10: 77,726,726 V81M probably benign Het
Gm12367 T C 4: 35,235,690 noncoding transcript Het
Gm15922 T C 7: 3,738,857 T175A possibly damaging Het
Grxcr1 C A 5: 68,166,195 T272K probably damaging Het
Kcna5 C T 6: 126,534,896 D90N probably benign Het
Kdm5b T A 1: 134,608,897 Y618* probably null Het
Lama5 T A 2: 180,190,746 H1670L possibly damaging Het
Mtus2 C T 5: 148,306,708 Q113* probably null Het
Ncam1 A C 9: 49,544,754 D521E probably benign Het
Nkapl T C 13: 21,467,570 H291R possibly damaging Het
Nlrp1b T G 11: 71,172,141 N695H probably damaging Het
Npc1l1 T A 11: 6,214,733 Q1105H probably damaging Het
Paxip1 C G 5: 27,781,455 probably benign Het
Pign A T 1: 105,655,970 W136R probably damaging Het
Pkn3 T A 2: 30,081,074 S222T probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppfibp1 T A 6: 146,996,840 I98N probably damaging Het
Ppfibp1 T G 6: 147,016,330 S484A probably damaging Het
Ppp1r7 T C 1: 93,352,590 F127L probably damaging Het
Pramel1 T C 4: 143,397,384 Y210H probably benign Het
Rad21l C T 2: 151,653,483 V427I probably benign Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rnf225 A G 7: 12,928,005 D37G probably damaging Het
Smpd2 A G 10: 41,487,971 probably null Het
Tmem38b C T 4: 53,859,945 R242W probably benign Het
Topaz1 A T 9: 122,774,093 K1035I possibly damaging Het
Trhr T C 15: 44,197,477 I131T possibly damaging Het
Usp1 A G 4: 98,931,057 D252G probably benign Het
Usp14 C T 18: 10,018,023 E90K probably damaging Het
Yme1l1 T G 2: 23,162,557 D74E probably benign Het
Ythdc2 T A 18: 44,857,025 L732Q possibly damaging Het
Zbbx G T 3: 75,083,670 A289D probably damaging Het
Zfhx3 G A 8: 108,946,814 V1499I possibly damaging Het
Zfp622 T C 15: 25,996,199 V184A possibly damaging Het
Other mutations in Camta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Camta1 APN 4 151071424 critical splice donor site probably null
IGL00823:Camta1 APN 4 151084601 missense probably benign 0.02
IGL01361:Camta1 APN 4 151144692 missense probably damaging 1.00
IGL01523:Camta1 APN 4 151145050 missense possibly damaging 0.73
IGL01730:Camta1 APN 4 151062845 missense probably damaging 0.99
IGL02045:Camta1 APN 4 151073985 splice site probably null
IGL02541:Camta1 APN 4 151084655 missense probably benign 0.12
IGL02839:Camta1 APN 4 151144512 missense probably damaging 1.00
IGL03012:Camta1 APN 4 151453299 missense probably damaging 1.00
PIT4449001:Camta1 UTSW 4 151131586 missense probably benign 0.00
R0136:Camta1 UTSW 4 151078969 missense probably damaging 0.99
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0239:Camta1 UTSW 4 151143730 missense probably damaging 1.00
R0276:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0346:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0347:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0348:Camta1 UTSW 4 151586431 missense possibly damaging 0.64
R0385:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0386:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0388:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0410:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0456:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0478:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0510:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0511:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0683:Camta1 UTSW 4 151075140 missense probably damaging 1.00
R0724:Camta1 UTSW 4 151077892 missense probably damaging 1.00
R0732:Camta1 UTSW 4 151586484 critical splice acceptor site probably null
R1549:Camta1 UTSW 4 151586463 missense probably damaging 1.00
R1670:Camta1 UTSW 4 151079771 missense probably benign 0.00
R1704:Camta1 UTSW 4 151075224 missense probably damaging 1.00
R1718:Camta1 UTSW 4 151084024 missense probably benign 0.00
R1941:Camta1 UTSW 4 151075155 missense probably damaging 1.00
R1967:Camta1 UTSW 4 151088973 missense probably damaging 0.99
R1998:Camta1 UTSW 4 151077880 missense probably damaging 1.00
R2081:Camta1 UTSW 4 151144242 missense probably benign 0.24
R2104:Camta1 UTSW 4 151453294 missense probably damaging 0.99
R2240:Camta1 UTSW 4 151084575 missense possibly damaging 0.66
R4516:Camta1 UTSW 4 151144720 missense possibly damaging 0.90
R4539:Camta1 UTSW 4 151084812 missense probably benign 0.03
R4552:Camta1 UTSW 4 151792502 missense probably damaging 0.96
R4610:Camta1 UTSW 4 151084827 missense probably damaging 1.00
R4658:Camta1 UTSW 4 151143910 missense probably damaging 1.00
R4725:Camta1 UTSW 4 151148496 missense probably benign 0.11
R4786:Camta1 UTSW 4 151290039 missense probably damaging 1.00
R4812:Camta1 UTSW 4 151131542 missense probably null 0.25
R4840:Camta1 UTSW 4 151144407 missense probably benign 0.23
R5038:Camta1 UTSW 4 151145469 missense probably damaging 1.00
R5112:Camta1 UTSW 4 151074054 missense probably damaging 1.00
R5251:Camta1 UTSW 4 151163884 missense probably damaging 1.00
R5487:Camta1 UTSW 4 151144754 missense possibly damaging 0.73
R6343:Camta1 UTSW 4 151079849 missense probably damaging 0.98
R6462:Camta1 UTSW 4 151086164 missense probably damaging 0.98
R6550:Camta1 UTSW 4 151138375 missense probably damaging 1.00
R6990:Camta1 UTSW 4 151145044 missense probably damaging 0.97
R7165:Camta1 UTSW 4 151084700 missense possibly damaging 0.63
R7190:Camta1 UTSW 4 151148523 missense possibly damaging 0.57
R7215:Camta1 UTSW 4 151144737 missense probably damaging 1.00
R7264:Camta1 UTSW 4 151453399 missense probably damaging 1.00
R7403:Camta1 UTSW 4 151453295 nonsense probably null
R7445:Camta1 UTSW 4 151144291 missense possibly damaging 0.94
R7447:Camta1 UTSW 4 151083870 missense probably benign 0.31
R7585:Camta1 UTSW 4 151144830 missense probably damaging 1.00
R7881:Camta1 UTSW 4 151835876 missense probably damaging 0.99
R7964:Camta1 UTSW 4 151835876 missense probably damaging 0.99
R8057:Camta1 UTSW 4 151144032 missense not run
R8073:Camta1 UTSW 4 151078824 missense not run
X0063:Camta1 UTSW 4 151145247 missense probably damaging 1.00
Z1176:Camta1 UTSW 4 151144385 missense not run
Z1177:Camta1 UTSW 4 151077925 missense not run
Predicted Primers PCR Primer
(F):5'- AGGTCTAGGTACTGTGCCAG -3'
(R):5'- TGGAAAAGTACTGGAAGCTTGCTG -3'

Sequencing Primer
(F):5'- GAGCCTCTGCCACACCCTG -3'
(R):5'- ACTGGAAGCTTGCTGTTGGC -3'
Posted On2016-08-04