Incidental Mutation 'R5388:Mtus2'
ID425405
Institutional Source Beutler Lab
Gene Symbol Mtus2
Ensembl Gene ENSMUSG00000029651
Gene Namemicrotubule associated tumor suppressor candidate 2
Synonyms
MMRRC Submission 042960-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R5388 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location147957320-148316065 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 148306708 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 113 (Q113*)
Ref Sequence ENSEMBL: ENSMUSP00000123055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071878] [ENSMUST00000085554] [ENSMUST00000085558] [ENSMUST00000110514] [ENSMUST00000110515] [ENSMUST00000146425] [ENSMUST00000152105]
Predicted Effect probably benign
Transcript: ENSMUST00000071878
SMART Domains Protein: ENSMUSP00000071775
Gene: ENSMUSG00000029651

DomainStartEndE-ValueType
coiled coil region 19 75 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085554
AA Change: Q76*
SMART Domains Protein: ENSMUSP00000082690
Gene: ENSMUSG00000029651
AA Change: Q76*

DomainStartEndE-ValueType
coiled coil region 15 118 N/A INTRINSIC
low complexity region 131 148 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085558
AA Change: Q1277*
SMART Domains Protein: ENSMUSP00000082694
Gene: ENSMUSG00000029651
AA Change: Q1277*

DomainStartEndE-ValueType
internal_repeat_1 57 290 2.46e-5 PROSPERO
internal_repeat_1 312 525 2.46e-5 PROSPERO
low complexity region 530 541 N/A INTRINSIC
low complexity region 802 818 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
coiled coil region 1029 1080 N/A INTRINSIC
SCOP:d1fxkc_ 1167 1294 3e-4 SMART
low complexity region 1332 1349 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110514
AA Change: Q239*
SMART Domains Protein: ENSMUSP00000106143
Gene: ENSMUSG00000029651
AA Change: Q239*

DomainStartEndE-ValueType
coiled coil region 19 75 N/A INTRINSIC
coiled coil region 144 281 N/A INTRINSIC
low complexity region 294 311 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110515
AA Change: Q272*
SMART Domains Protein: ENSMUSP00000106144
Gene: ENSMUSG00000029651
AA Change: Q272*

DomainStartEndE-ValueType
coiled coil region 19 75 N/A INTRINSIC
coiled coil region 144 314 N/A INTRINSIC
low complexity region 327 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146425
Predicted Effect probably null
Transcript: ENSMUST00000152105
AA Change: Q113*
SMART Domains Protein: ENSMUSP00000123055
Gene: ENSMUSG00000029651
AA Change: Q113*

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
coiled coil region 52 155 N/A INTRINSIC
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,727 Q4483R probably damaging Het
Abca16 T C 7: 120,540,746 probably null Het
Acap2 C A 16: 31,109,725 C475F probably damaging Het
Ace C A 11: 105,988,458 P603Q possibly damaging Het
Adamts20 C G 15: 94,345,778 V657L possibly damaging Het
Antxr2 A G 5: 97,977,599 probably null Het
Atp6v1b2 G A 8: 69,101,437 V89I probably benign Het
Cacna1e G A 1: 154,477,796 P676L probably damaging Het
Camsap3 A T 8: 3,604,276 I649F probably damaging Het
Camta1 G T 4: 151,075,238 S490R probably damaging Het
Celsr1 A G 15: 85,925,518 I2221T probably damaging Het
Cfd A T 10: 79,892,125 D164V probably damaging Het
Cfdp1 T C 8: 111,768,752 D278G probably damaging Het
Cntn6 A T 6: 104,832,562 L519F probably damaging Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Cybrd1 T C 2: 71,137,645 probably null Het
Cyp2e1 T C 7: 140,763,993 L48P probably damaging Het
Ep400 G A 5: 110,701,728 T1409I unknown Het
Epp13 T C 7: 6,266,347 probably null Het
Exosc7 A T 9: 123,118,907 D47V probably damaging Het
Fgr T C 4: 132,995,031 F204L probably damaging Het
Gm10100 G A 10: 77,726,726 V81M probably benign Het
Gm12367 T C 4: 35,235,690 noncoding transcript Het
Gm15922 T C 7: 3,738,857 T175A possibly damaging Het
Grxcr1 C A 5: 68,166,195 T272K probably damaging Het
Kcna5 C T 6: 126,534,896 D90N probably benign Het
Kdm5b T A 1: 134,608,897 Y618* probably null Het
Lama5 T A 2: 180,190,746 H1670L possibly damaging Het
Ncam1 A C 9: 49,544,754 D521E probably benign Het
Nkapl T C 13: 21,467,570 H291R possibly damaging Het
Nlrp1b T G 11: 71,172,141 N695H probably damaging Het
Npc1l1 T A 11: 6,214,733 Q1105H probably damaging Het
Paxip1 C G 5: 27,781,455 probably benign Het
Pign A T 1: 105,655,970 W136R probably damaging Het
Pkn3 T A 2: 30,081,074 S222T probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppfibp1 T A 6: 146,996,840 I98N probably damaging Het
Ppfibp1 T G 6: 147,016,330 S484A probably damaging Het
Ppp1r7 T C 1: 93,352,590 F127L probably damaging Het
Pramel1 T C 4: 143,397,384 Y210H probably benign Het
Rad21l C T 2: 151,653,483 V427I probably benign Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rnf225 A G 7: 12,928,005 D37G probably damaging Het
Smpd2 A G 10: 41,487,971 probably null Het
Tmem38b C T 4: 53,859,945 R242W probably benign Het
Topaz1 A T 9: 122,774,093 K1035I possibly damaging Het
Trhr T C 15: 44,197,477 I131T possibly damaging Het
Usp1 A G 4: 98,931,057 D252G probably benign Het
Usp14 C T 18: 10,018,023 E90K probably damaging Het
Yme1l1 T G 2: 23,162,557 D74E probably benign Het
Ythdc2 T A 18: 44,857,025 L732Q possibly damaging Het
Zbbx G T 3: 75,083,670 A289D probably damaging Het
Zfhx3 G A 8: 108,946,814 V1499I possibly damaging Het
Zfp622 T C 15: 25,996,199 V184A possibly damaging Het
Other mutations in Mtus2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Mtus2 APN 5 148077009 unclassified probably null
IGL01911:Mtus2 APN 5 148078220 missense probably benign 0.00
IGL01973:Mtus2 APN 5 148303476 splice site probably benign
IGL02452:Mtus2 APN 5 148077663 missense probably benign 0.01
IGL02476:Mtus2 APN 5 148077938 missense probably benign 0.01
IGL02716:Mtus2 APN 5 148236310 missense probably benign 0.05
IGL03194:Mtus2 APN 5 148107103 missense probably damaging 1.00
rumblado UTSW 5 148306708 nonsense probably null
IGL02991:Mtus2 UTSW 5 148313500 missense probably damaging 1.00
PIT4431001:Mtus2 UTSW 5 148076705 missense probably benign 0.01
R0101:Mtus2 UTSW 5 148083035 missense probably damaging 1.00
R0101:Mtus2 UTSW 5 148083035 missense probably damaging 1.00
R0310:Mtus2 UTSW 5 148107019 missense probably benign 0.17
R0729:Mtus2 UTSW 5 148077287 missense probably benign 0.08
R0968:Mtus2 UTSW 5 148078184 missense probably benign 0.09
R1231:Mtus2 UTSW 5 148077388 missense probably benign 0.01
R1253:Mtus2 UTSW 5 148303570 nonsense probably null
R1556:Mtus2 UTSW 5 148077388 missense probably benign 0.01
R1561:Mtus2 UTSW 5 148076552 missense probably benign 0.07
R1574:Mtus2 UTSW 5 148076552 missense probably benign 0.07
R1750:Mtus2 UTSW 5 148277633 missense probably damaging 0.97
R2318:Mtus2 UTSW 5 148107082 nonsense probably null
R2327:Mtus2 UTSW 5 148077915 missense probably benign 0.00
R3153:Mtus2 UTSW 5 148083060 missense probably damaging 1.00
R3154:Mtus2 UTSW 5 148303273 intron probably benign
R3158:Mtus2 UTSW 5 148231827 missense probably damaging 1.00
R3548:Mtus2 UTSW 5 148295506 missense probably damaging 1.00
R3861:Mtus2 UTSW 5 148313413 missense probably damaging 1.00
R4395:Mtus2 UTSW 5 148076622 missense probably benign 0.17
R4396:Mtus2 UTSW 5 148203938 missense possibly damaging 0.81
R4667:Mtus2 UTSW 5 148298260 missense possibly damaging 0.64
R4887:Mtus2 UTSW 5 148077103 nonsense probably null
R4931:Mtus2 UTSW 5 148077416 missense probably benign 0.09
R5097:Mtus2 UTSW 5 148295582 missense probably damaging 0.99
R5318:Mtus2 UTSW 5 148076572 missense probably benign 0.05
R5372:Mtus2 UTSW 5 148313412 missense probably damaging 1.00
R5622:Mtus2 UTSW 5 148078434 missense probably benign 0.09
R6009:Mtus2 UTSW 5 148306652 missense probably damaging 1.00
R6379:Mtus2 UTSW 5 148077198 missense probably benign 0.00
R6409:Mtus2 UTSW 5 148077615 missense probably benign
R6527:Mtus2 UTSW 5 148277598 critical splice acceptor site probably null
R6853:Mtus2 UTSW 5 148107011 missense probably damaging 1.00
R7001:Mtus2 UTSW 5 148277628 missense probably damaging 1.00
R7187:Mtus2 UTSW 5 148076705 missense probably benign 0.01
R7276:Mtus2 UTSW 5 148076558 missense probably benign
R7594:Mtus2 UTSW 5 148077406 missense probably benign 0.44
R7790:Mtus2 UTSW 5 148078188 missense probably benign 0.09
X0017:Mtus2 UTSW 5 148277600 missense possibly damaging 0.83
X0028:Mtus2 UTSW 5 148077318 missense probably benign 0.03
Z1088:Mtus2 UTSW 5 148303263 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGTTTAGCAAAGCACTGTTCCC -3'
(R):5'- TCTTCACTCACTTACGGGGAAC -3'

Sequencing Primer
(F):5'- TGTTCCCAGAGATCCTCCAAAGTG -3'
(R):5'- AGGCAGAGCTGGGATGTGC -3'
Posted On2016-08-04