Incidental Mutation 'R0492:Sh2b2'
ID 42544
Institutional Source Beutler Lab
Gene Symbol Sh2b2
Ensembl Gene ENSMUSG00000005057
Gene Name SH2B adaptor protein 2
Synonyms Aps
MMRRC Submission 038690-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.937) question?
Stock # R0492 (G1)
Quality Score 144
Status Validated
Chromosome 5
Chromosomal Location 136218147-136246556 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 136232263 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 33 (F33S)
Ref Sequence ENSEMBL: ENSMUSP00000142398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005188] [ENSMUST00000196245] [ENSMUST00000196397] [ENSMUST00000196447]
AlphaFold Q9JID9
Predicted Effect probably damaging
Transcript: ENSMUST00000005188
AA Change: F33S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005188
Gene: ENSMUSG00000005057
AA Change: F33S

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
Pfam:Phe_ZIP 17 73 9.3e-22 PFAM
Blast:PH 95 168 2e-21 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 4.97e-9 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
SH2 407 492 1.38e-21 SMART
low complexity region 509 525 N/A INTRINSIC
low complexity region 548 576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196245
AA Change: F33S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000196397
AA Change: F33S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142398
Gene: ENSMUSG00000005057
AA Change: F33S

DomainStartEndE-ValueType
Pfam:Phe_ZIP 16 74 1.5e-30 PFAM
Blast:PH 95 168 2e-21 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 4.97e-9 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
SH2 407 492 1.38e-21 SMART
low complexity region 509 525 N/A INTRINSIC
low complexity region 548 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196447
AA Change: F33S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142728
Gene: ENSMUSG00000005057
AA Change: F33S

DomainStartEndE-ValueType
Pfam:Phe_ZIP 16 74 9.1e-28 PFAM
Blast:PH 95 168 9e-22 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 2.2e-11 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
Meta Mutation Damage Score 0.9316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
PHENOTYPE: Inactivation of this gene results in increased insulin sensitivity accompanied by hypoinsulinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A T 5: 24,554,628 L48Q probably damaging Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Adgre1 A G 17: 57,402,742 D133G unknown Het
AI314180 A G 4: 58,864,418 W288R probably damaging Het
Alpl A C 4: 137,749,576 probably null Het
Ankrd65 T C 4: 155,790,676 probably benign Het
Baalc A T 15: 38,934,085 probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Bud31 A G 5: 145,146,455 Y77C probably damaging Het
Capsl A G 15: 9,461,844 probably benign Het
Ccna1 A G 3: 55,048,583 V116A probably damaging Het
Cdc42bpa C A 1: 180,101,190 H723N probably benign Het
Cfap161 T C 7: 83,794,037 I40V possibly damaging Het
CK137956 C T 4: 127,951,300 V217I probably benign Het
Cog5 A G 12: 31,869,461 T540A probably damaging Het
Cps1 T C 1: 67,157,836 W349R probably damaging Het
Crispld2 G T 8: 120,026,067 V285L probably benign Het
Crtc2 T A 3: 90,263,497 F626I probably damaging Het
Daam1 G A 12: 71,944,380 R256H unknown Het
Dhx38 G T 8: 109,561,944 probably benign Het
Dok4 G A 8: 94,865,136 A324V probably benign Het
Dscam T C 16: 96,825,782 probably null Het
Dusp16 A T 6: 134,718,402 S489T probably benign Het
Erbin A T 13: 103,834,358 Y917N probably damaging Het
F13b A T 1: 139,522,559 probably null Het
Fam26f G A 10: 34,127,651 R87* probably null Het
Fdx1 C A 9: 51,963,425 A15S probably benign Het
Ffar4 A T 19: 38,097,182 Q19L probably benign Het
Folh1 A C 7: 86,746,192 V344G probably damaging Het
Fscb T A 12: 64,473,518 E391D possibly damaging Het
Gigyf2 G A 1: 87,440,846 G1083R probably damaging Het
Gm14403 C A 2: 177,508,566 H102N probably benign Het
Gm4847 A G 1: 166,630,392 F464S probably damaging Het
Gpam A T 19: 55,096,179 M56K possibly damaging Het
Gpr165 T A X: 96,717,172 F352I probably damaging Het
Grik2 T G 10: 49,101,164 I891L probably damaging Het
Gsr T C 8: 33,681,575 probably benign Het
Hhla1 A G 15: 65,936,291 F302L probably benign Het
Impg1 T C 9: 80,345,308 D453G possibly damaging Het
Inpp5d T A 1: 87,698,150 V495E possibly damaging Het
Iqce A T 5: 140,675,235 L450H probably damaging Het
Itfg2 A G 6: 128,413,523 probably null Het
Kif13a A G 13: 46,812,742 V400A possibly damaging Het
Kif7 T C 7: 79,713,881 Y93C probably damaging Het
Krt33a A G 11: 100,016,083 V22A probably benign Het
Lct T C 1: 128,300,582 D1058G probably damaging Het
Lrp6 G T 6: 134,480,518 D774E possibly damaging Het
Lrrc9 T A 12: 72,478,763 S828R possibly damaging Het
Ly75 A G 2: 60,308,276 W1416R probably damaging Het
Mdh2 T C 5: 135,790,150 I320T possibly damaging Het
Med13l T A 5: 118,738,495 V912E probably damaging Het
Mgarp T C 3: 51,389,035 D182G possibly damaging Het
Mllt10 T C 2: 18,146,887 probably benign Het
Mmp28 G A 11: 83,443,803 A375V probably damaging Het
Mrps23 T A 11: 88,210,685 H133Q probably benign Het
Msh6 T C 17: 87,975,251 S35P probably benign Het
Myo3a A G 2: 22,323,636 D347G possibly damaging Het
Npc1l1 T C 11: 6,223,040 K800E possibly damaging Het
Olfr1034 T C 2: 86,046,587 V35A probably benign Het
Olfr1034 T C 2: 86,046,934 F151L possibly damaging Het
Olfr1086 G A 2: 86,676,490 P281L probably damaging Het
Olfr152 T G 2: 87,782,822 I94S probably damaging Het
Olfr414 T A 1: 174,430,563 I45N possibly damaging Het
Olfr632 T C 7: 103,937,764 I128T probably benign Het
Olfr695 A T 7: 106,873,877 Y123N probably damaging Het
Osmr A C 15: 6,824,518 W570G probably damaging Het
Otol1 A T 3: 70,027,784 I370F probably damaging Het
Pank2 A G 2: 131,280,260 Y235C probably damaging Het
Pias2 T C 18: 77,105,885 S187P probably damaging Het
Pkhd1l1 A G 15: 44,519,690 N1115S probably benign Het
Pld1 G T 3: 28,109,817 A800S probably damaging Het
Prex2 T C 1: 11,186,633 probably benign Het
Ptpn3 T C 4: 57,194,304 Q908R probably benign Het
Rab3gap2 T A 1: 185,252,392 probably benign Het
Rbm24 A T 13: 46,420,350 N82Y probably damaging Het
Rpl27 T C 11: 101,445,255 V47A possibly damaging Het
Serpina1f A G 12: 103,693,567 V152A possibly damaging Het
Serpina5 A G 12: 104,102,133 Y151C probably damaging Het
Serpinb7 A G 1: 107,452,007 *381W probably null Het
Slc22a2 A C 17: 12,615,272 I476L probably benign Het
Slc6a12 A T 6: 121,355,372 I222F probably benign Het
Smim26 G A 2: 144,595,113 D61N probably damaging Het
Soat1 A T 1: 156,441,354 Y209N probably benign Het
Sorl1 T C 9: 41,991,371 H1630R probably null Het
Sptlc2 A T 12: 87,346,806 probably null Het
Strn3 G A 12: 51,610,404 T642I probably damaging Het
Syce1l T A 8: 113,654,068 D137E possibly damaging Het
Syne2 T C 12: 75,982,063 probably null Het
Tcf25 C A 8: 123,381,464 P86Q probably benign Het
Tmem19 A T 10: 115,361,810 Y43* probably null Het
Tmem30b T C 12: 73,546,168 N58D probably benign Het
Tnn A C 1: 160,120,757 I795M probably damaging Het
Tnpo1 A G 13: 98,855,446 Y641H probably damaging Het
Tra2a A T 6: 49,250,955 probably benign Het
Trappc8 A T 18: 20,866,186 F295I probably benign Het
Vmn2r101 T A 17: 19,588,983 W125R probably damaging Het
Vps8 C A 16: 21,442,357 F82L probably damaging Het
Ythdf2 A T 4: 132,204,468 S460R probably damaging Het
Other mutations in Sh2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sh2b2 APN 5 136224419 missense probably damaging 1.00
IGL01456:Sh2b2 APN 5 136224467 missense probably damaging 0.98
IGL01612:Sh2b2 APN 5 136231802 missense probably benign 0.02
IGL02798:Sh2b2 APN 5 136221963 missense probably damaging 1.00
BB002:Sh2b2 UTSW 5 136224261 missense probably benign 0.04
BB012:Sh2b2 UTSW 5 136224261 missense probably benign 0.04
R0539:Sh2b2 UTSW 5 136225301 splice site probably benign
R0707:Sh2b2 UTSW 5 136232263 missense probably damaging 1.00
R1569:Sh2b2 UTSW 5 136231735 missense possibly damaging 0.89
R1777:Sh2b2 UTSW 5 136227422 missense probably damaging 1.00
R2088:Sh2b2 UTSW 5 136232114 missense possibly damaging 0.87
R3702:Sh2b2 UTSW 5 136224233 missense probably damaging 0.99
R4223:Sh2b2 UTSW 5 136219053 missense possibly damaging 0.91
R4597:Sh2b2 UTSW 5 136231762 missense probably damaging 0.99
R4683:Sh2b2 UTSW 5 136231720 missense probably damaging 1.00
R4766:Sh2b2 UTSW 5 136231957 missense probably damaging 0.99
R5486:Sh2b2 UTSW 5 136232090 missense probably benign 0.10
R6060:Sh2b2 UTSW 5 136232355 missense possibly damaging 0.72
R6322:Sh2b2 UTSW 5 136224188 missense probably damaging 0.99
R7020:Sh2b2 UTSW 5 136224299 missense possibly damaging 0.69
R7034:Sh2b2 UTSW 5 136218885 missense probably benign 0.18
R7036:Sh2b2 UTSW 5 136218885 missense probably benign 0.18
R7615:Sh2b2 UTSW 5 136219657 missense probably damaging 1.00
R7715:Sh2b2 UTSW 5 136219035 missense probably benign 0.09
R7925:Sh2b2 UTSW 5 136224261 missense probably benign 0.04
R8244:Sh2b2 UTSW 5 136227437 nonsense probably null
R8291:Sh2b2 UTSW 5 136232355 missense possibly damaging 0.72
R8786:Sh2b2 UTSW 5 136231804 missense probably benign 0.29
R9293:Sh2b2 UTSW 5 136232039 missense possibly damaging 0.90
R9364:Sh2b2 UTSW 5 136224152 missense probably benign 0.03
R9554:Sh2b2 UTSW 5 136224152 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCATGTTACGCAGCGAGAATCCC -3'
(R):5'- TCTGTGGTGGACAGACGATATCCC -3'

Sequencing Primer
(F):5'- AGTCTTGAGCGCAGATGTCAC -3'
(R):5'- aaaaaaaagaagaaaaaagggaggg -3'
Posted On 2013-05-23