Mutagenetix > Incidental Mutation

Incidental Mutation 'R0492:Sh2b2'

42544

Institutional Source

Beutler Lab

Gene Symbol

Sh2b2

Ensembl Gene

ENSMUSG00000005057

Gene Name

SH2B adaptor protein 2

Synonyms

Aps

MMRRC Submission

038690-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R0492 (G1)

Quality Score

144

Status

Validated

Chromosome

Chromosomal Location

136218147-136246556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 136232263 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 33 (F33S)

Ref Sequence

ENSEMBL: ENSMUSP00000142398 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005188] [ENSMUST00000196245] [ENSMUST00000196397] [ENSMUST00000196447]

AlphaFold

Q9JID9

Predicted Effect

probably damaging
Transcript: ENSMUST00000005188
AA Change: F33S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000005188
Gene: ENSMUSG00000005057
AA Change: F33S

Domain	Start	End	E-Value	Type
low complexity region	6	16	N/A	INTRINSIC
Pfam:Phe_ZIP	17	73	9.3e-22	PFAM
Blast:PH	95	168	2e-21	BLAST
low complexity region	169	180	N/A	INTRINSIC
PH	187	301	4.97e-9	SMART
low complexity region	340	350	N/A	INTRINSIC
low complexity region	388	404	N/A	INTRINSIC
SH2	407	492	1.38e-21	SMART
low complexity region	509	525	N/A	INTRINSIC
low complexity region	548	576	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000196245
AA Change: F33S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

probably damaging
Transcript: ENSMUST00000196397
AA Change: F33S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142398
Gene: ENSMUSG00000005057
AA Change: F33S

Domain	Start	End	E-Value	Type
Pfam:Phe_ZIP	16	74	1.5e-30	PFAM
Blast:PH	95	168	2e-21	BLAST
low complexity region	169	180	N/A	INTRINSIC
PH	187	301	4.97e-9	SMART
low complexity region	340	350	N/A	INTRINSIC
low complexity region	388	404	N/A	INTRINSIC
SH2	407	492	1.38e-21	SMART
low complexity region	509	525	N/A	INTRINSIC
low complexity region	548	576	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000196447
AA Change: F33S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142728
Gene: ENSMUSG00000005057
AA Change: F33S

Domain	Start	End	E-Value	Type
Pfam:Phe_ZIP	16	74	9.1e-28	PFAM
Blast:PH	95	168	9e-22	BLAST
low complexity region	169	180	N/A	INTRINSIC
PH	187	301	2.2e-11	SMART
low complexity region	340	350	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC

Meta Mutation Damage Score

0.9316

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

99% (99/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
PHENOTYPE: Inactivation of this gene results in increased insulin sensitivity accompanied by hypoinsulinemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	T	5: 24,554,628	L48Q	probably damaging	Het
Adgrb2	C	G	4: 130,007,831	P416R	probably damaging	Het
Adgre1	A	G	17: 57,402,742	D133G	unknown	Het
AI314180	A	G	4: 58,864,418	W288R	probably damaging	Het
Alpl	A	C	4: 137,749,576		probably null	Het
Ankrd65	T	C	4: 155,790,676		probably benign	Het
Baalc	A	T	15: 38,934,085		probably benign	Het
Bpifb5	A	G	2: 154,228,900	T204A	probably benign	Het
Bud31	A	G	5: 145,146,455	Y77C	probably damaging	Het
Capsl	A	G	15: 9,461,844		probably benign	Het
Ccna1	A	G	3: 55,048,583	V116A	probably damaging	Het
Cdc42bpa	C	A	1: 180,101,190	H723N	probably benign	Het
Cfap161	T	C	7: 83,794,037	I40V	possibly damaging	Het
CK137956	C	T	4: 127,951,300	V217I	probably benign	Het
Cog5	A	G	12: 31,869,461	T540A	probably damaging	Het
Cps1	T	C	1: 67,157,836	W349R	probably damaging	Het
Crispld2	G	T	8: 120,026,067	V285L	probably benign	Het
Crtc2	T	A	3: 90,263,497	F626I	probably damaging	Het
Daam1	G	A	12: 71,944,380	R256H	unknown	Het
Dhx38	G	T	8: 109,561,944		probably benign	Het
Dok4	G	A	8: 94,865,136	A324V	probably benign	Het
Dscam	T	C	16: 96,825,782		probably null	Het
Dusp16	A	T	6: 134,718,402	S489T	probably benign	Het
Erbin	A	T	13: 103,834,358	Y917N	probably damaging	Het
F13b	A	T	1: 139,522,559		probably null	Het
Fam26f	G	A	10: 34,127,651	R87*	probably null	Het
Fdx1	C	A	9: 51,963,425	A15S	probably benign	Het
Ffar4	A	T	19: 38,097,182	Q19L	probably benign	Het
Folh1	A	C	7: 86,746,192	V344G	probably damaging	Het
Fscb	T	A	12: 64,473,518	E391D	possibly damaging	Het
Gigyf2	G	A	1: 87,440,846	G1083R	probably damaging	Het
Gm14403	C	A	2: 177,508,566	H102N	probably benign	Het
Gm4847	A	G	1: 166,630,392	F464S	probably damaging	Het
Gpam	A	T	19: 55,096,179	M56K	possibly damaging	Het
Gpr165	T	A	X: 96,717,172	F352I	probably damaging	Het
Grik2	T	G	10: 49,101,164	I891L	probably damaging	Het
Gsr	T	C	8: 33,681,575		probably benign	Het
Hhla1	A	G	15: 65,936,291	F302L	probably benign	Het
Impg1	T	C	9: 80,345,308	D453G	possibly damaging	Het
Inpp5d	T	A	1: 87,698,150	V495E	possibly damaging	Het
Iqce	A	T	5: 140,675,235	L450H	probably damaging	Het
Itfg2	A	G	6: 128,413,523		probably null	Het
Kif13a	A	G	13: 46,812,742	V400A	possibly damaging	Het
Kif7	T	C	7: 79,713,881	Y93C	probably damaging	Het
Krt33a	A	G	11: 100,016,083	V22A	probably benign	Het
Lct	T	C	1: 128,300,582	D1058G	probably damaging	Het
Lrp6	G	T	6: 134,480,518	D774E	possibly damaging	Het
Lrrc9	T	A	12: 72,478,763	S828R	possibly damaging	Het
Ly75	A	G	2: 60,308,276	W1416R	probably damaging	Het
Mdh2	T	C	5: 135,790,150	I320T	possibly damaging	Het
Med13l	T	A	5: 118,738,495	V912E	probably damaging	Het
Mgarp	T	C	3: 51,389,035	D182G	possibly damaging	Het
Mllt10	T	C	2: 18,146,887		probably benign	Het
Mmp28	G	A	11: 83,443,803	A375V	probably damaging	Het
Mrps23	T	A	11: 88,210,685	H133Q	probably benign	Het
Msh6	T	C	17: 87,975,251	S35P	probably benign	Het
Myo3a	A	G	2: 22,323,636	D347G	possibly damaging	Het
Npc1l1	T	C	11: 6,223,040	K800E	possibly damaging	Het
Olfr1034	T	C	2: 86,046,587	V35A	probably benign	Het
Olfr1034	T	C	2: 86,046,934	F151L	possibly damaging	Het
Olfr1086	G	A	2: 86,676,490	P281L	probably damaging	Het
Olfr152	T	G	2: 87,782,822	I94S	probably damaging	Het
Olfr414	T	A	1: 174,430,563	I45N	possibly damaging	Het
Olfr632	T	C	7: 103,937,764	I128T	probably benign	Het
Olfr695	A	T	7: 106,873,877	Y123N	probably damaging	Het
Osmr	A	C	15: 6,824,518	W570G	probably damaging	Het
Otol1	A	T	3: 70,027,784	I370F	probably damaging	Het
Pank2	A	G	2: 131,280,260	Y235C	probably damaging	Het
Pias2	T	C	18: 77,105,885	S187P	probably damaging	Het
Pkhd1l1	A	G	15: 44,519,690	N1115S	probably benign	Het
Pld1	G	T	3: 28,109,817	A800S	probably damaging	Het
Prex2	T	C	1: 11,186,633		probably benign	Het
Ptpn3	T	C	4: 57,194,304	Q908R	probably benign	Het
Rab3gap2	T	A	1: 185,252,392		probably benign	Het
Rbm24	A	T	13: 46,420,350	N82Y	probably damaging	Het
Rpl27	T	C	11: 101,445,255	V47A	possibly damaging	Het
Serpina1f	A	G	12: 103,693,567	V152A	possibly damaging	Het
Serpina5	A	G	12: 104,102,133	Y151C	probably damaging	Het
Serpinb7	A	G	1: 107,452,007	*381W	probably null	Het
Slc22a2	A	C	17: 12,615,272	I476L	probably benign	Het
Slc6a12	A	T	6: 121,355,372	I222F	probably benign	Het
Smim26	G	A	2: 144,595,113	D61N	probably damaging	Het
Soat1	A	T	1: 156,441,354	Y209N	probably benign	Het
Sorl1	T	C	9: 41,991,371	H1630R	probably null	Het
Sptlc2	A	T	12: 87,346,806		probably null	Het
Strn3	G	A	12: 51,610,404	T642I	probably damaging	Het
Syce1l	T	A	8: 113,654,068	D137E	possibly damaging	Het
Syne2	T	C	12: 75,982,063		probably null	Het
Tcf25	C	A	8: 123,381,464	P86Q	probably benign	Het
Tmem19	A	T	10: 115,361,810	Y43*	probably null	Het
Tmem30b	T	C	12: 73,546,168	N58D	probably benign	Het
Tnn	A	C	1: 160,120,757	I795M	probably damaging	Het
Tnpo1	A	G	13: 98,855,446	Y641H	probably damaging	Het
Tra2a	A	T	6: 49,250,955		probably benign	Het
Trappc8	A	T	18: 20,866,186	F295I	probably benign	Het
Vmn2r101	T	A	17: 19,588,983	W125R	probably damaging	Het
Vps8	C	A	16: 21,442,357	F82L	probably damaging	Het
Ythdf2	A	T	4: 132,204,468	S460R	probably damaging	Het

Other mutations in Sh2b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Sh2b2	APN	5	136224419	missense	probably damaging	1.00
IGL01456:Sh2b2	APN	5	136224467	missense	probably damaging	0.98
IGL01612:Sh2b2	APN	5	136231802	missense	probably benign	0.02
IGL02798:Sh2b2	APN	5	136221963	missense	probably damaging	1.00
BB002:Sh2b2	UTSW	5	136224261	missense	probably benign	0.04
BB012:Sh2b2	UTSW	5	136224261	missense	probably benign	0.04
R0539:Sh2b2	UTSW	5	136225301	splice site	probably benign
R0707:Sh2b2	UTSW	5	136232263	missense	probably damaging	1.00
R1569:Sh2b2	UTSW	5	136231735	missense	possibly damaging	0.89
R1777:Sh2b2	UTSW	5	136227422	missense	probably damaging	1.00
R2088:Sh2b2	UTSW	5	136232114	missense	possibly damaging	0.87
R3702:Sh2b2	UTSW	5	136224233	missense	probably damaging	0.99
R4223:Sh2b2	UTSW	5	136219053	missense	possibly damaging	0.91
R4597:Sh2b2	UTSW	5	136231762	missense	probably damaging	0.99
R4683:Sh2b2	UTSW	5	136231720	missense	probably damaging	1.00
R4766:Sh2b2	UTSW	5	136231957	missense	probably damaging	0.99
R5486:Sh2b2	UTSW	5	136232090	missense	probably benign	0.10
R6060:Sh2b2	UTSW	5	136232355	missense	possibly damaging	0.72
R6322:Sh2b2	UTSW	5	136224188	missense	probably damaging	0.99
R7020:Sh2b2	UTSW	5	136224299	missense	possibly damaging	0.69
R7034:Sh2b2	UTSW	5	136218885	missense	probably benign	0.18
R7036:Sh2b2	UTSW	5	136218885	missense	probably benign	0.18
R7615:Sh2b2	UTSW	5	136219657	missense	probably damaging	1.00
R7715:Sh2b2	UTSW	5	136219035	missense	probably benign	0.09
R7925:Sh2b2	UTSW	5	136224261	missense	probably benign	0.04
R8244:Sh2b2	UTSW	5	136227437	nonsense	probably null
R8291:Sh2b2	UTSW	5	136232355	missense	possibly damaging	0.72
R8786:Sh2b2	UTSW	5	136231804	missense	probably benign	0.29
R9293:Sh2b2	UTSW	5	136232039	missense	possibly damaging	0.90
R9364:Sh2b2	UTSW	5	136224152	missense	probably benign	0.03
R9554:Sh2b2	UTSW	5	136224152	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCATGTTACGCAGCGAGAATCCC -3'
(R):5'- TCTGTGGTGGACAGACGATATCCC -3'

Sequencing Primer
(F):5'- AGTCTTGAGCGCAGATGTCAC -3'
(R):5'- aaaaaaaagaagaaaaaagggaggg -3'

Posted On

2013-05-23