Mutagenetix > Incidental Mutation

Incidental Mutation 'R5389:Nfx1'

425457

Institutional Source

Beutler Lab

Gene Symbol

Nfx1

Ensembl Gene

ENSMUSG00000028423

Gene Name

nuclear transcription factor, X-box binding 1

Synonyms

1300017N15Rik, Tex42, 3000003M19Rik, TEG-42

MMRRC Submission

042961-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.516) question?

Stock #

R5389 (G1)

Quality Score

173

Status

Validated

Chromosome

Chromosomal Location

40970906-41025993 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40985000 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 375 (F375L)

Ref Sequence

ENSEMBL: ENSMUSP00000095747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030133] [ENSMUST00000091614] [ENSMUST00000098143]

AlphaFold

B1AY10

Predicted Effect

probably damaging
Transcript: ENSMUST00000030133
AA Change: F375L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030133
Gene: ENSMUSG00000028423
AA Change: F375L

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000091614
AA Change: F375L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089203
Gene: ENSMUSG00000028423
AA Change: F375L

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098143
AA Change: F375L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095747
Gene: ENSMUSG00000028423
AA Change: F375L

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART
ZnF_NFX	826	848	7.7e-5	SMART
ZnF_NFX	857	878	4.23e-2	SMART
coiled coil region	930	956	N/A	INTRINSIC
R3H	977	1055	1.38e-22	SMART
low complexity region	1070	1088	N/A	INTRINSIC

Meta Mutation Damage Score

0.1321

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	T	C	18: 6,638,795	V398A	probably benign	Het
A430033K04Rik	T	A	5: 138,646,297	V148E	probably benign	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Ankrd26	T	A	6: 118,508,575	Q1446L	possibly damaging	Het
Anks6	A	T	4: 47,038,900		probably benign	Het
Arrb2	T	C	11: 70,438,658	S265P	probably damaging	Het
Baiap2	T	C	11: 119,996,670	S264P	probably damaging	Het
Cadps2	A	G	6: 23,329,104	V938A	probably damaging	Het
Cavin4	G	T	4: 48,663,907	V96F	probably damaging	Het
Cenpe	T	C	3: 135,259,388		probably null	Het
Crocc2	C	A	1: 93,215,641	Q1322K	probably benign	Het
Cryzl2	T	A	1: 157,461,976	C61*	probably null	Het
Dazl	T	C	17: 50,288,690	I56V	probably benign	Het
Dnah12	A	T	14: 26,735,749	D890V	probably damaging	Het
Dnah9	C	A	11: 66,095,314	E1165*	probably null	Het
Dnmt3l	T	A	10: 78,056,831		probably null	Het
Elp2	A	G	18: 24,606,903	N62S	possibly damaging	Het
Fam216b	T	A	14: 78,085,063	H26L	possibly damaging	Het
Fbxw25	T	A	9: 109,652,886	Q244L	possibly damaging	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Gm1966	T	C	7: 106,598,235		noncoding transcript	Het
Gm5724	A	G	6: 141,740,467	F216L	probably benign	Het
Igf2r	T	C	17: 12,725,416	Y400C	probably damaging	Het
Iqcc	A	G	4: 129,618,620	F20L	probably benign	Het
Klhl5	T	A	5: 65,141,282	L135M	possibly damaging	Het
Klk1b16	A	T	7: 44,140,988	M196L	possibly damaging	Het
Ltf	T	C	9: 111,029,651	M489T	possibly damaging	Het
Mctp2	G	T	7: 72,214,087	R343S	possibly damaging	Het
Nbas	T	A	12: 13,534,577		probably null	Het
Ncr1	A	T	7: 4,340,933	M177L	probably benign	Het
Net1	C	T	13: 3,886,170	E305K	probably damaging	Het
Notch3	T	A	17: 32,139,189	I1687L	probably benign	Het
Obsl1	A	T	1: 75,503,261		probably benign	Het
Olfr1000	A	G	2: 85,608,283	F209S	probably benign	Het
Olfr1052	G	A	2: 86,298,217	V134M	possibly damaging	Het
Olfr325	C	G	11: 58,580,999	L52V	possibly damaging	Het
Olfr507	A	C	7: 108,622,717	I302L	probably damaging	Het
Olfr620	G	T	7: 103,611,590	Y254*	probably null	Het
Olfr698	A	T	7: 106,753,083	F102I	probably damaging	Het
Orai1	A	T	5: 123,029,501	M246L	probably benign	Het
Pcdhga12	G	A	18: 37,766,732	A206T	probably damaging	Het
Plxdc2	C	A	2: 16,650,187	T199K	probably damaging	Het
Prkd1	T	A	12: 50,343,137	I819F	probably damaging	Het
Ptpn9	T	C	9: 57,056,837		probably benign	Het
Rabl6	T	C	2: 25,588,654	E255G	probably damaging	Het
Sdccag3	T	C	2: 26,385,547	D244G	probably damaging	Het
Sema3e	T	C	5: 14,236,085		probably benign	Het
Serpina3c	T	C	12: 104,149,440	M282V	possibly damaging	Het
Slco2b1	A	G	7: 99,685,925	I216T	probably damaging	Het
Slco6b1	T	C	1: 96,988,584		noncoding transcript	Het
Slco6d1	A	T	1: 98,443,644	I285F	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Sp9	C	A	2: 73,274,297	N398K	probably damaging	Het
Sycp2	A	C	2: 178,377,702		probably null	Het
Tbc1d23	T	C	16: 57,198,928	D219G	probably damaging	Het
Tdpoz3	A	G	3: 93,826,872	R285G	probably benign	Het
Trim2	T	A	3: 84,167,653	Q694L	probably null	Het
Trim23	T	A	13: 104,192,033	V293D	probably damaging	Het
Ttn	A	G	2: 76,834,839		probably benign	Het
Vmn2r12	T	A	5: 109,090,395	Y493F	probably benign	Het
Vps41	T	A	13: 18,862,538	I753N	probably damaging	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Yme1l1	G	A	2: 23,193,234	G571R	probably damaging	Het
Zfp322a	A	T	13: 23,356,979	C198S	probably damaging	Het

Other mutations in Nfx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Nfx1	APN	4	40977241	missense	probably benign	0.00
IGL01998:Nfx1	APN	4	41004353	missense	probably damaging	1.00
IGL02072:Nfx1	APN	4	41016119	missense	probably benign
IGL02170:Nfx1	APN	4	41018019	missense	probably damaging	1.00
IGL02188:Nfx1	APN	4	40993827	missense	probably damaging	1.00
IGL02502:Nfx1	APN	4	40976345	splice site	probably benign
IGL02674:Nfx1	APN	4	40999717	critical splice donor site	probably null
IGL03007:Nfx1	APN	4	40984962	missense	probably benign	0.02
IGL03092:Nfx1	APN	4	41024851	missense	probably damaging	1.00
IGL03303:Nfx1	APN	4	41004323	splice site	probably benign
K7371:Nfx1	UTSW	4	40976803	missense	probably damaging	1.00
PIT4498001:Nfx1	UTSW	4	40977244	missense	probably benign
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R0069:Nfx1	UTSW	4	40986688	splice site	probably benign
R1056:Nfx1	UTSW	4	41003057	missense	probably damaging	0.97
R1449:Nfx1	UTSW	4	40976803	missense	probably damaging	1.00
R1635:Nfx1	UTSW	4	40977004	missense	probably benign
R1636:Nfx1	UTSW	4	41016072	splice site	probably null
R1882:Nfx1	UTSW	4	41009240	missense	possibly damaging	0.55
R2089:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R3792:Nfx1	UTSW	4	41004357	nonsense	probably null
R3793:Nfx1	UTSW	4	41004357	nonsense	probably null
R4668:Nfx1	UTSW	4	40976367	missense	possibly damaging	0.50
R4678:Nfx1	UTSW	4	41012070	missense	probably benign	0.01
R4894:Nfx1	UTSW	4	40996877	missense	probably damaging	1.00
R4972:Nfx1	UTSW	4	40976375	missense	probably benign	0.36
R5066:Nfx1	UTSW	4	40991868	missense	probably benign
R5429:Nfx1	UTSW	4	41004343	missense	probably damaging	1.00
R5643:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5644:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5915:Nfx1	UTSW	4	40977285	missense	probably benign	0.02
R6286:Nfx1	UTSW	4	40986728	missense	probably damaging	1.00
R6393:Nfx1	UTSW	4	40976851	missense	possibly damaging	0.92
R7409:Nfx1	UTSW	4	41021830	missense	possibly damaging	0.64
R7523:Nfx1	UTSW	4	41016119	missense	probably benign
R7916:Nfx1	UTSW	4	40977142	missense	probably benign	0.11
R8497:Nfx1	UTSW	4	40976968	missense	possibly damaging	0.67
R8799:Nfx1	UTSW	4	41023727	missense	probably damaging	1.00
R9154:Nfx1	UTSW	4	40990845	missense	probably damaging	1.00
R9364:Nfx1	UTSW	4	41023756	missense	probably benign	0.31
R9497:Nfx1	UTSW	4	40994104	missense	probably benign	0.00
X0025:Nfx1	UTSW	4	40976422	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CTCATTGACTCAAGTGAGGGG -3'
(R):5'- ATTTAAGATCTACAAGTCCAGCCAC -3'

Sequencing Primer
(F):5'- ACTCAAGTGAGGGGTAGTTTCATATG -3'
(R):5'- AGACAGGGTCTGTGTAGCTC -3'

Posted On

2016-08-04