Incidental Mutation 'R5389:Olfr698'
ID425476
Institutional Source Beutler Lab
Gene Symbol Olfr698
Ensembl Gene ENSMUSG00000059087
Gene Nameolfactory receptor 698
SynonymsMOR283-3, GA_x6K02T2PBJ9-9130754-9129519
MMRRC Submission 042961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5389 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106749889-106755397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106753083 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 102 (F102I)
Ref Sequence ENSEMBL: ENSMUSP00000149305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074981] [ENSMUST00000214306] [ENSMUST00000216255]
Predicted Effect probably damaging
Transcript: ENSMUST00000074981
AA Change: F102I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074509
Gene: ENSMUSG00000059087
AA Change: F102I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.4e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 305 9.8e-8 PFAM
Pfam:7tm_1 41 290 4.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214306
AA Change: F102I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215892
Predicted Effect probably damaging
Transcript: ENSMUST00000216255
AA Change: F102I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.2686 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,638,795 V398A probably benign Het
A430033K04Rik T A 5: 138,646,297 V148E probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Ankrd26 T A 6: 118,508,575 Q1446L possibly damaging Het
Anks6 A T 4: 47,038,900 probably benign Het
Arrb2 T C 11: 70,438,658 S265P probably damaging Het
Baiap2 T C 11: 119,996,670 S264P probably damaging Het
Cadps2 A G 6: 23,329,104 V938A probably damaging Het
Cavin4 G T 4: 48,663,907 V96F probably damaging Het
Cenpe T C 3: 135,259,388 probably null Het
Crocc2 C A 1: 93,215,641 Q1322K probably benign Het
Cryzl2 T A 1: 157,461,976 C61* probably null Het
Dazl T C 17: 50,288,690 I56V probably benign Het
Dnah12 A T 14: 26,735,749 D890V probably damaging Het
Dnah9 C A 11: 66,095,314 E1165* probably null Het
Dnmt3l T A 10: 78,056,831 probably null Het
Elp2 A G 18: 24,606,903 N62S possibly damaging Het
Fam216b T A 14: 78,085,063 H26L possibly damaging Het
Fbxw25 T A 9: 109,652,886 Q244L possibly damaging Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Gm1966 T C 7: 106,598,235 noncoding transcript Het
Gm5724 A G 6: 141,740,467 F216L probably benign Het
Igf2r T C 17: 12,725,416 Y400C probably damaging Het
Iqcc A G 4: 129,618,620 F20L probably benign Het
Klhl5 T A 5: 65,141,282 L135M possibly damaging Het
Klk1b16 A T 7: 44,140,988 M196L possibly damaging Het
Ltf T C 9: 111,029,651 M489T possibly damaging Het
Mctp2 G T 7: 72,214,087 R343S possibly damaging Het
Nbas T A 12: 13,534,577 probably null Het
Ncr1 A T 7: 4,340,933 M177L probably benign Het
Net1 C T 13: 3,886,170 E305K probably damaging Het
Nfx1 T C 4: 40,985,000 F375L probably damaging Het
Notch3 T A 17: 32,139,189 I1687L probably benign Het
Obsl1 A T 1: 75,503,261 probably benign Het
Olfr1000 A G 2: 85,608,283 F209S probably benign Het
Olfr1052 G A 2: 86,298,217 V134M possibly damaging Het
Olfr325 C G 11: 58,580,999 L52V possibly damaging Het
Olfr507 A C 7: 108,622,717 I302L probably damaging Het
Olfr620 G T 7: 103,611,590 Y254* probably null Het
Orai1 A T 5: 123,029,501 M246L probably benign Het
Pcdhga12 G A 18: 37,766,732 A206T probably damaging Het
Plxdc2 C A 2: 16,650,187 T199K probably damaging Het
Prkd1 T A 12: 50,343,137 I819F probably damaging Het
Ptpn9 T C 9: 57,056,837 probably benign Het
Rabl6 T C 2: 25,588,654 E255G probably damaging Het
Sdccag3 T C 2: 26,385,547 D244G probably damaging Het
Sema3e T C 5: 14,236,085 probably benign Het
Serpina3c T C 12: 104,149,440 M282V possibly damaging Het
Slco2b1 A G 7: 99,685,925 I216T probably damaging Het
Slco6b1 T C 1: 96,988,584 noncoding transcript Het
Slco6d1 A T 1: 98,443,644 I285F probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Sp9 C A 2: 73,274,297 N398K probably damaging Het
Sycp2 A C 2: 178,377,702 probably null Het
Tbc1d23 T C 16: 57,198,928 D219G probably damaging Het
Tdpoz3 A G 3: 93,826,872 R285G probably benign Het
Trim2 T A 3: 84,167,653 Q694L probably null Het
Trim23 T A 13: 104,192,033 V293D probably damaging Het
Ttn A G 2: 76,834,839 probably benign Het
Vmn2r12 T A 5: 109,090,395 Y493F probably benign Het
Vps41 T A 13: 18,862,538 I753N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Yme1l1 G A 2: 23,193,234 G571R probably damaging Het
Zfp322a A T 13: 23,356,979 C198S probably damaging Het
Other mutations in Olfr698
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Olfr698 APN 7 106752446 utr 3 prime probably benign
IGL01901:Olfr698 APN 7 106752545 missense possibly damaging 0.52
IGL01912:Olfr698 APN 7 106752992 missense probably damaging 1.00
IGL01998:Olfr698 APN 7 106752551 missense possibly damaging 0.63
IGL02640:Olfr698 APN 7 106753352 missense probably damaging 1.00
IGL03195:Olfr698 APN 7 106752773 missense probably benign
R0255:Olfr698 UTSW 7 106752989 missense probably benign 0.19
R1104:Olfr698 UTSW 7 106752782 missense probably benign 0.37
R1796:Olfr698 UTSW 7 106752549 missense probably benign 0.02
R1909:Olfr698 UTSW 7 106752995 missense probably benign 0.21
R4133:Olfr698 UTSW 7 106753079 missense probably damaging 0.98
R5194:Olfr698 UTSW 7 106753219 missense probably benign 0.15
R5426:Olfr698 UTSW 7 106752566 missense probably benign
R6162:Olfr698 UTSW 7 106753020 missense probably damaging 1.00
R6463:Olfr698 UTSW 7 106752801 missense probably benign 0.23
R6643:Olfr698 UTSW 7 106752569 missense probably benign 0.41
R6831:Olfr698 UTSW 7 106752571 missense probably damaging 0.99
R6972:Olfr698 UTSW 7 106752699 missense possibly damaging 0.60
R7392:Olfr698 UTSW 7 106753382 missense possibly damaging 0.69
R7717:Olfr698 UTSW 7 106752636 missense possibly damaging 0.58
R7852:Olfr698 UTSW 7 106752638 missense probably damaging 0.98
R7935:Olfr698 UTSW 7 106752638 missense probably damaging 0.98
R8073:Olfr698 UTSW 7 106752801 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAATACTGCATGGTGTAGATGC -3'
(R):5'- GTACTTCTTAGCCCTGACCAGC -3'

Sequencing Primer
(F):5'- TGCTATATCCTAGAGCACTGAGG -3'
(R):5'- TCTTAGCCCTGACCAGCAATGG -3'
Posted On2016-08-04