Incidental Mutation 'R0492:Slc6a12'
ID42548
Institutional Source Beutler Lab
Gene Symbol Slc6a12
Ensembl Gene ENSMUSG00000030109
Gene Namesolute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
SynonymsBGT1, Gabt2
MMRRC Submission 038690-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0492 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121343076-121365775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121355372 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 222 (I222F)
Ref Sequence ENSEMBL: ENSMUSP00000126708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032200] [ENSMUST00000163771] [ENSMUST00000165456] [ENSMUST00000166390] [ENSMUST00000166457] [ENSMUST00000171008]
Predicted Effect probably benign
Transcript: ENSMUST00000032200
AA Change: I236F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032200
Gene: ENSMUSG00000030109
AA Change: I236F

DomainStartEndE-ValueType
Pfam:SNF 50 575 2e-242 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163771
SMART Domains Protein: ENSMUSP00000127779
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 1 128 3.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165456
SMART Domains Protein: ENSMUSP00000130715
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 1 49 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166390
SMART Domains Protein: ENSMUSP00000128217
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
low complexity region 35 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166457
AA Change: I222F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126937
Gene: ENSMUSG00000030109
AA Change: I222F

DomainStartEndE-ValueType
Pfam:SNF 36 561 2.5e-242 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170582
Predicted Effect probably benign
Transcript: ENSMUST00000171008
AA Change: I222F

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126708
Gene: ENSMUSG00000030109
AA Change: I222F

DomainStartEndE-ValueType
Pfam:SNF 36 518 1.5e-227 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171874
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 99% (99/100)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal seizure threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A T 5: 24,554,628 L48Q probably damaging Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Adgre1 A G 17: 57,402,742 D133G unknown Het
AI314180 A G 4: 58,864,418 W288R probably damaging Het
Alpl A C 4: 137,749,576 probably null Het
Ankrd65 T C 4: 155,790,676 probably benign Het
Baalc A T 15: 38,934,085 probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Bud31 A G 5: 145,146,455 Y77C probably damaging Het
Capsl A G 15: 9,461,844 probably benign Het
Ccna1 A G 3: 55,048,583 V116A probably damaging Het
Cdc42bpa C A 1: 180,101,190 H723N probably benign Het
Cfap161 T C 7: 83,794,037 I40V possibly damaging Het
CK137956 C T 4: 127,951,300 V217I probably benign Het
Cog5 A G 12: 31,869,461 T540A probably damaging Het
Cps1 T C 1: 67,157,836 W349R probably damaging Het
Crispld2 G T 8: 120,026,067 V285L probably benign Het
Crtc2 T A 3: 90,263,497 F626I probably damaging Het
Daam1 G A 12: 71,944,380 R256H unknown Het
Dhx38 G T 8: 109,561,944 probably benign Het
Dok4 G A 8: 94,865,136 A324V probably benign Het
Dscam T C 16: 96,825,782 probably null Het
Dusp16 A T 6: 134,718,402 S489T probably benign Het
Erbin A T 13: 103,834,358 Y917N probably damaging Het
F13b A T 1: 139,522,559 probably null Het
Fam26f G A 10: 34,127,651 R87* probably null Het
Fdx1 C A 9: 51,963,425 A15S probably benign Het
Ffar4 A T 19: 38,097,182 Q19L probably benign Het
Folh1 A C 7: 86,746,192 V344G probably damaging Het
Fscb T A 12: 64,473,518 E391D possibly damaging Het
Gigyf2 G A 1: 87,440,846 G1083R probably damaging Het
Gm14403 C A 2: 177,508,566 H102N probably benign Het
Gm4847 A G 1: 166,630,392 F464S probably damaging Het
Gpam A T 19: 55,096,179 M56K possibly damaging Het
Gpr165 T A X: 96,717,172 F352I probably damaging Het
Grik2 T G 10: 49,101,164 I891L probably damaging Het
Gsr T C 8: 33,681,575 probably benign Het
Hhla1 A G 15: 65,936,291 F302L probably benign Het
Impg1 T C 9: 80,345,308 D453G possibly damaging Het
Inpp5d T A 1: 87,698,150 V495E possibly damaging Het
Iqce A T 5: 140,675,235 L450H probably damaging Het
Itfg2 A G 6: 128,413,523 probably null Het
Kif13a A G 13: 46,812,742 V400A possibly damaging Het
Kif7 T C 7: 79,713,881 Y93C probably damaging Het
Krt33a A G 11: 100,016,083 V22A probably benign Het
Lct T C 1: 128,300,582 D1058G probably damaging Het
Lrp6 G T 6: 134,480,518 D774E possibly damaging Het
Lrrc9 T A 12: 72,478,763 S828R possibly damaging Het
Ly75 A G 2: 60,308,276 W1416R probably damaging Het
Mdh2 T C 5: 135,790,150 I320T possibly damaging Het
Med13l T A 5: 118,738,495 V912E probably damaging Het
Mgarp T C 3: 51,389,035 D182G possibly damaging Het
Mllt10 T C 2: 18,146,887 probably benign Het
Mmp28 G A 11: 83,443,803 A375V probably damaging Het
Mrps23 T A 11: 88,210,685 H133Q probably benign Het
Msh6 T C 17: 87,975,251 S35P probably benign Het
Myo3a A G 2: 22,323,636 D347G possibly damaging Het
Npc1l1 T C 11: 6,223,040 K800E possibly damaging Het
Olfr1034 T C 2: 86,046,587 V35A probably benign Het
Olfr1034 T C 2: 86,046,934 F151L possibly damaging Het
Olfr1086 G A 2: 86,676,490 P281L probably damaging Het
Olfr152 T G 2: 87,782,822 I94S probably damaging Het
Olfr414 T A 1: 174,430,563 I45N possibly damaging Het
Olfr632 T C 7: 103,937,764 I128T probably benign Het
Olfr695 A T 7: 106,873,877 Y123N probably damaging Het
Osmr A C 15: 6,824,518 W570G probably damaging Het
Otol1 A T 3: 70,027,784 I370F probably damaging Het
Pank2 A G 2: 131,280,260 Y235C probably damaging Het
Pias2 T C 18: 77,105,885 S187P probably damaging Het
Pkhd1l1 A G 15: 44,519,690 N1115S probably benign Het
Pld1 G T 3: 28,109,817 A800S probably damaging Het
Prex2 T C 1: 11,186,633 probably benign Het
Ptpn3 T C 4: 57,194,304 Q908R probably benign Het
Rab3gap2 T A 1: 185,252,392 probably benign Het
Rbm24 A T 13: 46,420,350 N82Y probably damaging Het
Rpl27 T C 11: 101,445,255 V47A possibly damaging Het
Serpina1f A G 12: 103,693,567 V152A possibly damaging Het
Serpina5 A G 12: 104,102,133 Y151C probably damaging Het
Serpinb7 A G 1: 107,452,007 *381W probably null Het
Sh2b2 A G 5: 136,232,263 F33S probably damaging Het
Slc22a2 A C 17: 12,615,272 I476L probably benign Het
Smim26 G A 2: 144,595,113 D61N probably damaging Het
Soat1 A T 1: 156,441,354 Y209N probably benign Het
Sorl1 T C 9: 41,991,371 H1630R probably null Het
Sptlc2 A T 12: 87,346,806 probably null Het
Strn3 G A 12: 51,610,404 T642I probably damaging Het
Syce1l T A 8: 113,654,068 D137E possibly damaging Het
Syne2 T C 12: 75,982,063 probably null Het
Tcf25 C A 8: 123,381,464 P86Q probably benign Het
Tmem19 A T 10: 115,361,810 Y43* probably null Het
Tmem30b T C 12: 73,546,168 N58D probably benign Het
Tnn A C 1: 160,120,757 I795M probably damaging Het
Tnpo1 A G 13: 98,855,446 Y641H probably damaging Het
Tra2a A T 6: 49,250,955 probably benign Het
Trappc8 A T 18: 20,866,186 F295I probably benign Het
Vmn2r101 T A 17: 19,588,983 W125R probably damaging Het
Vps8 C A 16: 21,442,357 F82L probably damaging Het
Ythdf2 A T 4: 132,204,468 S460R probably damaging Het
Other mutations in Slc6a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Slc6a12 APN 6 121360455 missense probably damaging 1.00
IGL02066:Slc6a12 APN 6 121352056 missense probably damaging 0.97
IGL02146:Slc6a12 APN 6 121353501 missense probably benign 0.01
IGL02475:Slc6a12 APN 6 121354375 splice site probably null
IGL02498:Slc6a12 APN 6 121361070 missense probably benign
IGL02537:Slc6a12 APN 6 121360514 missense probably benign 0.00
IGL02696:Slc6a12 APN 6 121363252 missense probably benign 0.00
IGL03255:Slc6a12 APN 6 121354287 missense probably damaging 0.99
IGL03397:Slc6a12 APN 6 121357045 missense probably damaging 1.00
R0050:Slc6a12 UTSW 6 121360419 splice site probably benign
R0050:Slc6a12 UTSW 6 121360419 splice site probably benign
R0201:Slc6a12 UTSW 6 121355372 missense probably benign 0.03
R0255:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0302:Slc6a12 UTSW 6 121363259 missense probably damaging 1.00
R0317:Slc6a12 UTSW 6 121358625 missense possibly damaging 0.80
R0394:Slc6a12 UTSW 6 121346998 critical splice donor site probably null
R0532:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0550:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0551:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R1421:Slc6a12 UTSW 6 121359126 missense probably damaging 1.00
R1487:Slc6a12 UTSW 6 121363757 nonsense probably null
R1879:Slc6a12 UTSW 6 121347423 missense probably damaging 1.00
R1905:Slc6a12 UTSW 6 121347443 nonsense probably null
R1925:Slc6a12 UTSW 6 121360526 missense probably benign 0.44
R3944:Slc6a12 UTSW 6 121354280 critical splice acceptor site probably null
R4515:Slc6a12 UTSW 6 121353530 critical splice donor site probably null
R4559:Slc6a12 UTSW 6 121363861 splice site probably null
R4628:Slc6a12 UTSW 6 121351992 nonsense probably null
R4665:Slc6a12 UTSW 6 121359013 splice site probably benign
R4753:Slc6a12 UTSW 6 121356903 splice site probably benign
R4948:Slc6a12 UTSW 6 121355322 missense probably benign 0.35
R5517:Slc6a12 UTSW 6 121354339 missense probably benign 0.10
R6717:Slc6a12 UTSW 6 121354303 missense probably benign 0.01
R7139:Slc6a12 UTSW 6 121365319 missense probably benign
R7318:Slc6a12 UTSW 6 121352013 missense probably damaging 0.99
R7318:Slc6a12 UTSW 6 121352019 missense probably benign 0.26
Z1176:Slc6a12 UTSW 6 121363827 missense probably benign
Z1177:Slc6a12 UTSW 6 121356967 missense possibly damaging 0.95
Z1177:Slc6a12 UTSW 6 121365272 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTGACAGGCAGATTGTGCCCTATG -3'
(R):5'- TGATGCCCATCTTGGCTTAAACCC -3'

Sequencing Primer
(F):5'- ATTACATCGGGCATCCACGA -3'
(R):5'- GGCTTGGAAACCAATGAGTTCTC -3'
Posted On2013-05-23