Incidental Mutation 'R5389:Ltf'
ID425480
Institutional Source Beutler Lab
Gene Symbol Ltf
Ensembl Gene ENSMUSG00000032496
Gene Namelactotransferrin
SynonymsLf, lactoferrin
MMRRC Submission 042961-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5389 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location111019271-111042767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111029651 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 489 (M489T)
Ref Sequence ENSEMBL: ENSMUSP00000035077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035077] [ENSMUST00000196122] [ENSMUST00000196209] [ENSMUST00000198884]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035077
AA Change: M489T

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035077
Gene: ENSMUSG00000032496
AA Change: M489T

DomainStartEndE-ValueType
TR_FER 24 362 1.48e-209 SMART
TR_FER 363 696 4.68e-212 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196122
SMART Domains Protein: ENSMUSP00000143234
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
TR_FER 4 183 6.4e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196209
SMART Domains Protein: ENSMUSP00000143731
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
Pfam:Transferrin 13 78 3.5e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197893
Predicted Effect probably benign
Transcript: ENSMUST00000198152
Predicted Effect probably benign
Transcript: ENSMUST00000198884
SMART Domains Protein: ENSMUSP00000142432
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
TR_FER 1 95 4.3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199313
Predicted Effect probably benign
Transcript: ENSMUST00000199815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200459
Meta Mutation Damage Score 0.1191 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transferrin family of genes and its protein product is found in the secondary granules of neutrophils. The protein is a major iron-binding protein in milk and body secretions with an antimicrobial activity, making it an important component of the non-specific immune system. The protein demonstrates a broad spectrum of properties, including regulation of iron homeostasis, host defense against a broad range of microbial infections, anti-inflammatory activity, regulation of cellular growth and differentiation and protection against cancer development and metastasis. Antimicrobial, antiviral, antifungal and antiparasitic activity has been found for this protein and its peptides. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and grossly normal and exhibit only minor alterations in iron homeostasis. Mice homozygous for a different knock-out allele show increased susceptibility to inflammation-induced colorectal dysplasia along with increased cell proliferation and decreased apoptosis in colonic tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,638,795 V398A probably benign Het
A430033K04Rik T A 5: 138,646,297 V148E probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Ankrd26 T A 6: 118,508,575 Q1446L possibly damaging Het
Anks6 A T 4: 47,038,900 probably benign Het
Arrb2 T C 11: 70,438,658 S265P probably damaging Het
Baiap2 T C 11: 119,996,670 S264P probably damaging Het
Cadps2 A G 6: 23,329,104 V938A probably damaging Het
Cavin4 G T 4: 48,663,907 V96F probably damaging Het
Cenpe T C 3: 135,259,388 probably null Het
Crocc2 C A 1: 93,215,641 Q1322K probably benign Het
Cryzl2 T A 1: 157,461,976 C61* probably null Het
Dazl T C 17: 50,288,690 I56V probably benign Het
Dnah12 A T 14: 26,735,749 D890V probably damaging Het
Dnah9 C A 11: 66,095,314 E1165* probably null Het
Dnmt3l T A 10: 78,056,831 probably null Het
Elp2 A G 18: 24,606,903 N62S possibly damaging Het
Fam216b T A 14: 78,085,063 H26L possibly damaging Het
Fbxw25 T A 9: 109,652,886 Q244L possibly damaging Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Gm1966 T C 7: 106,598,235 noncoding transcript Het
Gm5724 A G 6: 141,740,467 F216L probably benign Het
Igf2r T C 17: 12,725,416 Y400C probably damaging Het
Iqcc A G 4: 129,618,620 F20L probably benign Het
Klhl5 T A 5: 65,141,282 L135M possibly damaging Het
Klk1b16 A T 7: 44,140,988 M196L possibly damaging Het
Mctp2 G T 7: 72,214,087 R343S possibly damaging Het
Nbas T A 12: 13,534,577 probably null Het
Ncr1 A T 7: 4,340,933 M177L probably benign Het
Net1 C T 13: 3,886,170 E305K probably damaging Het
Nfx1 T C 4: 40,985,000 F375L probably damaging Het
Notch3 T A 17: 32,139,189 I1687L probably benign Het
Obsl1 A T 1: 75,503,261 probably benign Het
Olfr1000 A G 2: 85,608,283 F209S probably benign Het
Olfr1052 G A 2: 86,298,217 V134M possibly damaging Het
Olfr325 C G 11: 58,580,999 L52V possibly damaging Het
Olfr507 A C 7: 108,622,717 I302L probably damaging Het
Olfr620 G T 7: 103,611,590 Y254* probably null Het
Olfr698 A T 7: 106,753,083 F102I probably damaging Het
Orai1 A T 5: 123,029,501 M246L probably benign Het
Pcdhga12 G A 18: 37,766,732 A206T probably damaging Het
Plxdc2 C A 2: 16,650,187 T199K probably damaging Het
Prkd1 T A 12: 50,343,137 I819F probably damaging Het
Ptpn9 T C 9: 57,056,837 probably benign Het
Rabl6 T C 2: 25,588,654 E255G probably damaging Het
Sdccag3 T C 2: 26,385,547 D244G probably damaging Het
Sema3e T C 5: 14,236,085 probably benign Het
Serpina3c T C 12: 104,149,440 M282V possibly damaging Het
Slco2b1 A G 7: 99,685,925 I216T probably damaging Het
Slco6b1 T C 1: 96,988,584 noncoding transcript Het
Slco6d1 A T 1: 98,443,644 I285F probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Sp9 C A 2: 73,274,297 N398K probably damaging Het
Sycp2 A C 2: 178,377,702 probably null Het
Tbc1d23 T C 16: 57,198,928 D219G probably damaging Het
Tdpoz3 A G 3: 93,826,872 R285G probably benign Het
Trim2 T A 3: 84,167,653 Q694L probably null Het
Trim23 T A 13: 104,192,033 V293D probably damaging Het
Ttn A G 2: 76,834,839 probably benign Het
Vmn2r12 T A 5: 109,090,395 Y493F probably benign Het
Vps41 T A 13: 18,862,538 I753N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Yme1l1 G A 2: 23,193,234 G571R probably damaging Het
Zfp322a A T 13: 23,356,979 C198S probably damaging Het
Other mutations in Ltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ltf APN 9 111022882 intron probably null
IGL01068:Ltf APN 9 111035812 unclassified probably null
IGL01311:Ltf APN 9 111031012 unclassified probably benign
IGL01629:Ltf APN 9 111035806 missense probably damaging 1.00
IGL01765:Ltf APN 9 111022017 missense possibly damaging 0.86
IGL02376:Ltf APN 9 111029624 missense probably benign 0.01
IGL02429:Ltf APN 9 111026125 missense possibly damaging 0.87
IGL02947:Ltf APN 9 111038947 missense probably benign 0.01
IGL03025:Ltf APN 9 111025101 missense possibly damaging 0.93
R0041:Ltf UTSW 9 111029568 missense possibly damaging 0.92
R0364:Ltf UTSW 9 111025167 missense probably benign 0.19
R0718:Ltf UTSW 9 111040379 missense probably benign 0.01
R1899:Ltf UTSW 9 111022845 missense possibly damaging 0.84
R1900:Ltf UTSW 9 111022845 missense possibly damaging 0.84
R2964:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R2965:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R2966:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R3051:Ltf UTSW 9 111024522 missense probably benign 0.00
R3122:Ltf UTSW 9 111022900 missense probably damaging 1.00
R4427:Ltf UTSW 9 111023604 missense probably damaging 1.00
R4597:Ltf UTSW 9 111022933 missense probably damaging 1.00
R4604:Ltf UTSW 9 111022341 missense probably damaging 0.99
R4827:Ltf UTSW 9 111027377 unclassified probably benign
R4849:Ltf UTSW 9 111025990 missense probably benign 0.00
R5677:Ltf UTSW 9 111020912 start codon destroyed probably null 0.01
R6419:Ltf UTSW 9 111031022 missense possibly damaging 0.67
R6891:Ltf UTSW 9 111025113 missense probably benign 0.13
R7032:Ltf UTSW 9 111026130 critical splice donor site probably null
R7090:Ltf UTSW 9 111025980 missense probably benign 0.00
R7352:Ltf UTSW 9 111028450 missense probably benign
R7656:Ltf UTSW 9 111024394 nonsense probably null
R7857:Ltf UTSW 9 111022376 missense probably benign 0.00
R7940:Ltf UTSW 9 111022376 missense probably benign 0.00
Z1177:Ltf UTSW 9 111021005 missense probably benign 0.01
Z1177:Ltf UTSW 9 111024393 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACTGTACTTGAATCCATGTGCAC -3'
(R):5'- TGTGCACCCATGGTTCCATG -3'

Sequencing Primer
(F):5'- GTGCACCCTAGAAGCTAAGATGTTC -3'
(R):5'- ATGGTTCCATGAGGCGAC -3'
Posted On2016-08-04