Incidental Mutation 'R5389:Acyp2'
ID425482
Institutional Source Beutler Lab
Gene Symbol Acyp2
Ensembl Gene ENSMUSG00000060923
Gene Nameacylphosphatase 2, muscle type
Synonyms
MMRRC Submission 042961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5389 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location30505991-30649587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30506354 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 98 (E98K)
Ref Sequence ENSEMBL: ENSMUSP00000074195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074613]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074613
AA Change: E98K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074195
Gene: ENSMUSG00000060923
AA Change: E98K

DomainStartEndE-ValueType
Pfam:Acylphosphatase 10 105 1.5e-26 PFAM
Meta Mutation Damage Score 0.1234 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acylphosphatase can hydrolyze the phosphoenzyme intermediate of different membrane pumps, particularly the Ca2+/Mg2+-ATPase from sarcoplasmic reticulum of skeletal muscle. Two isoenzymes have been isolated, called muscle acylphosphatase and erythrocyte acylphosphatase on the basis of their tissue localization. This gene encodes the muscle-type isoform (MT). An increase of the MT isoform is associated with muscle differentiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,638,795 V398A probably benign Het
A430033K04Rik T A 5: 138,646,297 V148E probably benign Het
Ankrd26 T A 6: 118,508,575 Q1446L possibly damaging Het
Anks6 A T 4: 47,038,900 probably benign Het
Arrb2 T C 11: 70,438,658 S265P probably damaging Het
Baiap2 T C 11: 119,996,670 S264P probably damaging Het
Cadps2 A G 6: 23,329,104 V938A probably damaging Het
Cavin4 G T 4: 48,663,907 V96F probably damaging Het
Cenpe T C 3: 135,259,388 probably null Het
Crocc2 C A 1: 93,215,641 Q1322K probably benign Het
Cryzl2 T A 1: 157,461,976 C61* probably null Het
Dazl T C 17: 50,288,690 I56V probably benign Het
Dnah12 A T 14: 26,735,749 D890V probably damaging Het
Dnah9 C A 11: 66,095,314 E1165* probably null Het
Dnmt3l T A 10: 78,056,831 probably null Het
Elp2 A G 18: 24,606,903 N62S possibly damaging Het
Fam216b T A 14: 78,085,063 H26L possibly damaging Het
Fbxw25 T A 9: 109,652,886 Q244L possibly damaging Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Gm1966 T C 7: 106,598,235 noncoding transcript Het
Gm5724 A G 6: 141,740,467 F216L probably benign Het
Igf2r T C 17: 12,725,416 Y400C probably damaging Het
Iqcc A G 4: 129,618,620 F20L probably benign Het
Klhl5 T A 5: 65,141,282 L135M possibly damaging Het
Klk1b16 A T 7: 44,140,988 M196L possibly damaging Het
Ltf T C 9: 111,029,651 M489T possibly damaging Het
Mctp2 G T 7: 72,214,087 R343S possibly damaging Het
Nbas T A 12: 13,534,577 probably null Het
Ncr1 A T 7: 4,340,933 M177L probably benign Het
Net1 C T 13: 3,886,170 E305K probably damaging Het
Nfx1 T C 4: 40,985,000 F375L probably damaging Het
Notch3 T A 17: 32,139,189 I1687L probably benign Het
Obsl1 A T 1: 75,503,261 probably benign Het
Olfr1000 A G 2: 85,608,283 F209S probably benign Het
Olfr1052 G A 2: 86,298,217 V134M possibly damaging Het
Olfr325 C G 11: 58,580,999 L52V possibly damaging Het
Olfr507 A C 7: 108,622,717 I302L probably damaging Het
Olfr620 G T 7: 103,611,590 Y254* probably null Het
Olfr698 A T 7: 106,753,083 F102I probably damaging Het
Orai1 A T 5: 123,029,501 M246L probably benign Het
Pcdhga12 G A 18: 37,766,732 A206T probably damaging Het
Plxdc2 C A 2: 16,650,187 T199K probably damaging Het
Prkd1 T A 12: 50,343,137 I819F probably damaging Het
Ptpn9 T C 9: 57,056,837 probably benign Het
Rabl6 T C 2: 25,588,654 E255G probably damaging Het
Sdccag3 T C 2: 26,385,547 D244G probably damaging Het
Sema3e T C 5: 14,236,085 probably benign Het
Serpina3c T C 12: 104,149,440 M282V possibly damaging Het
Slco2b1 A G 7: 99,685,925 I216T probably damaging Het
Slco6b1 T C 1: 96,988,584 noncoding transcript Het
Slco6d1 A T 1: 98,443,644 I285F probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Sp9 C A 2: 73,274,297 N398K probably damaging Het
Sycp2 A C 2: 178,377,702 probably null Het
Tbc1d23 T C 16: 57,198,928 D219G probably damaging Het
Tdpoz3 A G 3: 93,826,872 R285G probably benign Het
Trim2 T A 3: 84,167,653 Q694L probably null Het
Trim23 T A 13: 104,192,033 V293D probably damaging Het
Ttn A G 2: 76,834,839 probably benign Het
Vmn2r12 T A 5: 109,090,395 Y493F probably benign Het
Vps41 T A 13: 18,862,538 I753N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Yme1l1 G A 2: 23,193,234 G571R probably damaging Het
Zfp322a A T 13: 23,356,979 C198S probably damaging Het
Other mutations in Acyp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01587:Acyp2 APN 11 30506362 missense probably benign 0.07
IGL02365:Acyp2 APN 11 30649318 missense probably damaging 1.00
R1470:Acyp2 UTSW 11 30506452 splice site probably benign
R2419:Acyp2 UTSW 11 30632316 missense probably benign 0.20
R5393:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5423:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5425:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5426:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5460:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5462:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5464:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5560:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5561:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5602:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5826:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5901:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5902:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5999:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6046:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6066:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6107:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6128:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6196:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6198:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTCTGCTTGCTAAAACATAGGTGAG -3'
(R):5'- AGCAAGGTAATACTGACCTTGAAG -3'

Sequencing Primer
(F):5'- AGGTGAGTAAATGTTTTCAGTTTCAG -3'
(R):5'- GGTAATACTGACCTTGAAGAGTTTG -3'
Posted On2016-08-04