Incidental Mutation 'R5389:Dazl'
ID425496
Institutional Source Beutler Lab
Gene Symbol Dazl
Ensembl Gene ENSMUSG00000010592
Gene Namedeleted in azoospermia-like
SynonymsDaz-like, Tpx2, Dazla, Tpx-2
MMRRC Submission 042961-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5389 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location50279394-50293599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50288690 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 56 (I56V)
Ref Sequence ENSEMBL: ENSMUSP00000010736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010736]
PDB Structure
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH RNA, UUGUUCUU [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH MVH RNA, UGUUC [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH SYCP3 RNA, UUGUUU [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000010736
AA Change: I56V

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000010736
Gene: ENSMUSG00000010592
AA Change: I56V

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
RRM 41 111 2.16e-19 SMART
low complexity region 125 146 N/A INTRINSIC
Meta Mutation Damage Score 0.2380 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes a member of the depleted in azoospermia-like (DAZL) protein family. Members of this family contain an RNA recognition motif, interact with poly A binding proteins, and may be involved in the initiation of translation. The encoded protein is expressed in the cytoplasm of pluripotent stem cells, and in both male and female germ cells, where it is essential for gametogenesis. Disruption of this gene is associated with infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit sterility with a complete absence of mature germ cells. In mutants, few spermatogonia enter meiosis, and those that do fail to proceed beyond pachytene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,638,795 V398A probably benign Het
A430033K04Rik T A 5: 138,646,297 V148E probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Ankrd26 T A 6: 118,508,575 Q1446L possibly damaging Het
Anks6 A T 4: 47,038,900 probably benign Het
Arrb2 T C 11: 70,438,658 S265P probably damaging Het
Baiap2 T C 11: 119,996,670 S264P probably damaging Het
Cadps2 A G 6: 23,329,104 V938A probably damaging Het
Cavin4 G T 4: 48,663,907 V96F probably damaging Het
Cenpe T C 3: 135,259,388 probably null Het
Crocc2 C A 1: 93,215,641 Q1322K probably benign Het
Cryzl2 T A 1: 157,461,976 C61* probably null Het
Dnah12 A T 14: 26,735,749 D890V probably damaging Het
Dnah9 C A 11: 66,095,314 E1165* probably null Het
Dnmt3l T A 10: 78,056,831 probably null Het
Elp2 A G 18: 24,606,903 N62S possibly damaging Het
Fam216b T A 14: 78,085,063 H26L possibly damaging Het
Fbxw25 T A 9: 109,652,886 Q244L possibly damaging Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Gm1966 T C 7: 106,598,235 noncoding transcript Het
Gm5724 A G 6: 141,740,467 F216L probably benign Het
Igf2r T C 17: 12,725,416 Y400C probably damaging Het
Iqcc A G 4: 129,618,620 F20L probably benign Het
Klhl5 T A 5: 65,141,282 L135M possibly damaging Het
Klk1b16 A T 7: 44,140,988 M196L possibly damaging Het
Ltf T C 9: 111,029,651 M489T possibly damaging Het
Mctp2 G T 7: 72,214,087 R343S possibly damaging Het
Nbas T A 12: 13,534,577 probably null Het
Ncr1 A T 7: 4,340,933 M177L probably benign Het
Net1 C T 13: 3,886,170 E305K probably damaging Het
Nfx1 T C 4: 40,985,000 F375L probably damaging Het
Notch3 T A 17: 32,139,189 I1687L probably benign Het
Obsl1 A T 1: 75,503,261 probably benign Het
Olfr1000 A G 2: 85,608,283 F209S probably benign Het
Olfr1052 G A 2: 86,298,217 V134M possibly damaging Het
Olfr325 C G 11: 58,580,999 L52V possibly damaging Het
Olfr507 A C 7: 108,622,717 I302L probably damaging Het
Olfr620 G T 7: 103,611,590 Y254* probably null Het
Olfr698 A T 7: 106,753,083 F102I probably damaging Het
Orai1 A T 5: 123,029,501 M246L probably benign Het
Pcdhga12 G A 18: 37,766,732 A206T probably damaging Het
Plxdc2 C A 2: 16,650,187 T199K probably damaging Het
Prkd1 T A 12: 50,343,137 I819F probably damaging Het
Ptpn9 T C 9: 57,056,837 probably benign Het
Rabl6 T C 2: 25,588,654 E255G probably damaging Het
Sdccag3 T C 2: 26,385,547 D244G probably damaging Het
Sema3e T C 5: 14,236,085 probably benign Het
Serpina3c T C 12: 104,149,440 M282V possibly damaging Het
Slco2b1 A G 7: 99,685,925 I216T probably damaging Het
Slco6b1 T C 1: 96,988,584 noncoding transcript Het
Slco6d1 A T 1: 98,443,644 I285F probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Sp9 C A 2: 73,274,297 N398K probably damaging Het
Sycp2 A C 2: 178,377,702 probably null Het
Tbc1d23 T C 16: 57,198,928 D219G probably damaging Het
Tdpoz3 A G 3: 93,826,872 R285G probably benign Het
Trim2 T A 3: 84,167,653 Q694L probably null Het
Trim23 T A 13: 104,192,033 V293D probably damaging Het
Ttn A G 2: 76,834,839 probably benign Het
Vmn2r12 T A 5: 109,090,395 Y493F probably benign Het
Vps41 T A 13: 18,862,538 I753N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Yme1l1 G A 2: 23,193,234 G571R probably damaging Het
Zfp322a A T 13: 23,356,979 C198S probably damaging Het
Other mutations in Dazl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Dazl APN 17 50293398 splice site probably benign
R0063:Dazl UTSW 17 152705859 missense probably damaging 1.00
R3801:Dazl UTSW 17 50281281 missense probably benign 0.44
R3961:Dazl UTSW 17 50288133 missense probably damaging 0.99
R4646:Dazl UTSW 17 50288155 missense probably damaging 1.00
R5310:Dazl UTSW 17 50281283 missense probably damaging 1.00
R5933:Dazl UTSW 17 50287753 critical splice donor site probably null
R6173:Dazl UTSW 17 50287571 missense probably benign 0.05
R7057:Dazl UTSW 17 50293406 start codon destroyed probably null
R7523:Dazl UTSW 17 50287541 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCAACAATTTCAGTAGTTTGC -3'
(R):5'- ATTGGGAGCTGATGTGTAGACC -3'

Sequencing Primer
(F):5'- CAACAATTTCAGTAGTTTGCATGCTC -3'
(R):5'- GACCTAAAAGGATTTTCTGCTCC -3'
Posted On2016-08-04