Incidental Mutation 'R5390:Kctd10'
ID425510
Institutional Source Beutler Lab
Gene Symbol Kctd10
Ensembl Gene ENSMUSG00000001098
Gene Namepotassium channel tetramerisation domain containing 10
Synonyms
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.578) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location114363567-114380508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114365703 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 296 (I296T)
Ref Sequence ENSEMBL: ENSMUSP00000099641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001125] [ENSMUST00000102581] [ENSMUST00000124316] [ENSMUST00000134532] [ENSMUST00000169347] [ENSMUST00000196467] [ENSMUST00000196676] [ENSMUST00000199567] [ENSMUST00000202006]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001125
AA Change: I297T

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001125
Gene: ENSMUSG00000001098
AA Change: I297T

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
BTB 32 132 3.21e-19 SMART
low complexity region 287 303 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102581
AA Change: I296T

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099641
Gene: ENSMUSG00000001098
AA Change: I296T

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
BTB 32 132 6.89e-19 SMART
low complexity region 286 302 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123538
Predicted Effect probably benign
Transcript: ENSMUST00000124316
SMART Domains Protein: ENSMUSP00000118824
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 833 1015 5.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134173
Predicted Effect probably benign
Transcript: ENSMUST00000134532
SMART Domains Protein: ENSMUSP00000138564
Gene: ENSMUSG00000001098

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:BTB_2 34 89 2.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152694
Predicted Effect probably benign
Transcript: ENSMUST00000169347
SMART Domains Protein: ENSMUSP00000132905
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196467
SMART Domains Protein: ENSMUSP00000144133
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
Blast:MYSc 1 52 7e-10 BLAST
Pfam:Myosin_TH1 70 181 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196676
SMART Domains Protein: ENSMUSP00000144682
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
Pfam:Myosin_TH1 25 204 7.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197773
Predicted Effect probably benign
Transcript: ENSMUST00000199567
SMART Domains Protein: ENSMUSP00000144492
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
Pfam:Myosin_TH1 25 213 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202006
SMART Domains Protein: ENSMUSP00000144110
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds proliferating cell nuclear antigen (PCNA) and may be involved in DNA synthesis and cell proliferation. In addition, the encoded protein may be a tumor suppressor. Several protein-coding and non-protein coding transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E10.5 and E11.5, abnormal vasculature, absent vitelline circulation, enlarged pericardium, thin myocardium and defective heart valve defect formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Kctd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kctd10 APN 5 114367349 missense probably damaging 1.00
IGL00832:Kctd10 APN 5 114368936 splice site probably null
R1666:Kctd10 UTSW 5 114368990 missense probably benign 0.01
R2137:Kctd10 UTSW 5 114367328 missense probably damaging 1.00
R2223:Kctd10 UTSW 5 114367349 missense probably benign 0.26
R3037:Kctd10 UTSW 5 114375000 missense probably damaging 1.00
R3522:Kctd10 UTSW 5 114374923 missense probably damaging 1.00
R5794:Kctd10 UTSW 5 114367337 missense probably damaging 1.00
R5903:Kctd10 UTSW 5 114380462 unclassified probably benign
R6938:Kctd10 UTSW 5 114370130 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAAAAGTGTCTCAGACTCCAGG -3'
(R):5'- CCCTGCTGAGATGTAGTGTG -3'

Sequencing Primer
(F):5'- TCTCAGACTCCAGGGGAAGTG -3'
(R):5'- CCACCATGTATTTTGTGGGGCAC -3'
Posted On2016-08-04