Incidental Mutation 'R5390:Gpx3'
ID425533
Institutional Source Beutler Lab
Gene Symbol Gpx3
Ensembl Gene ENSMUSG00000018339
Gene Nameglutathione peroxidase 3
SynonymsGPx, EGPx, extracellular GPx, plasma GPx
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location54902453-54910377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54909549 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 191 (D191V)
Ref Sequence ENSEMBL: ENSMUSP00000081011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018482] [ENSMUST00000082430] [ENSMUST00000102730] [ENSMUST00000102731] [ENSMUST00000108885] [ENSMUST00000108886] [ENSMUST00000108889] [ENSMUST00000125094] [ENSMUST00000149324]
Predicted Effect probably benign
Transcript: ENSMUST00000018482
SMART Domains Protein: ENSMUSP00000018482
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082430
AA Change: D191V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081011
Gene: ENSMUSG00000018339
AA Change: D191V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:GSHPx 40 153 4.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102730
SMART Domains Protein: ENSMUSP00000099791
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 3e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102731
SMART Domains Protein: ENSMUSP00000099792
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108885
SMART Domains Protein: ENSMUSP00000104513
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108886
SMART Domains Protein: ENSMUSP00000104514
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108889
SMART Domains Protein: ENSMUSP00000104517
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124304
Predicted Effect possibly damaging
Transcript: ENSMUST00000125094
AA Change: D191V

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119165
Gene: ENSMUSG00000018339
AA Change: D191V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:GSHPx 40 153 1.6e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149324
SMART Domains Protein: ENSMUSP00000119882
Gene: ENSMUSG00000018339

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:GSHPx 40 83 1e-13 PFAM
Pfam:GSHPx 99 185 7.3e-28 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is secreted and is highly expressed in mouse kidney, which appears to be the major source of the enzyme in plasma. It has a role in mouse organogenesis, and dysregulation of this isozyme has been associated with obesity-related metabolic complications, platelet-dependent thrombosis, colitis-associated carcinoma, and thermosensitive phenotype. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced glutathione peroxidase activity, increase plasma selenium levels when mice are fed a selenium supplemented diet, and reduced kidney selenium levels regardless of selenium supplementation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Gpx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02125:Gpx3 APN 11 54907242 missense probably damaging 1.00
IGL02600:Gpx3 APN 11 54909607 missense possibly damaging 0.84
R0589:Gpx3 UTSW 11 54909503 missense probably benign 0.00
R0969:Gpx3 UTSW 11 54909026 splice site probably benign
R1344:Gpx3 UTSW 11 54909596 missense probably damaging 0.99
R1418:Gpx3 UTSW 11 54909596 missense probably damaging 0.99
R5105:Gpx3 UTSW 11 54907154 missense possibly damaging 0.82
R6476:Gpx3 UTSW 11 54907199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTTCTTGTTCCCGAACTGG -3'
(R):5'- GTGGCTTCCTTCCTGAAGAG -3'

Sequencing Primer
(F):5'- GCCCTTCCCTCAGTGCCAG -3'
(R):5'- TGAAGAGCCCCTCCTCG -3'
Posted On2016-08-04