Incidental Mutation 'R5376:4930430A15Rik'
ID425550
Institutional Source Beutler Lab
Gene Symbol 4930430A15Rik
Ensembl Gene ENSMUSG00000027157
Gene NameRIKEN cDNA 4930430A15 gene
Synonyms
MMRRC Submission 042952-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5376 (G1)
Quality Score223
Status Not validated
Chromosome2
Chromosomal Location111162061-111229602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111215599 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 286 (D286G)
Ref Sequence ENSEMBL: ENSMUSP00000028577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028577]
Predicted Effect probably benign
Transcript: ENSMUST00000028577
AA Change: D286G

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157
AA Change: D286G

DomainStartEndE-ValueType
ANK 78 107 1.61e-4 SMART
ANK 111 140 3.6e-2 SMART
ANK 144 173 4.89e-4 SMART
ANK 177 206 4.03e-5 SMART
ANK 210 239 8.72e-1 SMART
Blast:ANK 243 272 4e-12 BLAST
low complexity region 460 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G C 11: 120,012,034 S512W probably damaging Het
Abcc2 A T 19: 43,829,900 N1275I possibly damaging Het
Adgb T C 10: 10,346,563 T1455A probably benign Het
Apopt1 A G 12: 111,730,058 D142G probably damaging Het
Cnnm3 T A 1: 36,520,678 L566H probably damaging Het
Dennd4b C T 3: 90,278,056 P1229L probably benign Het
Dsc1 T G 18: 20,088,446 K657N probably benign Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Eef1d G T 15: 75,903,189 T207N probably benign Het
Eif4g1 T A 16: 20,683,827 Y955N probably damaging Het
Evi5l T C 8: 4,210,770 T1016A probably damaging Het
Fcrl6 G A 1: 172,599,280 T33M probably damaging Het
Golga3 T C 5: 110,220,945 probably null Het
Gpbp1 T C 13: 111,426,642 N425D probably damaging Het
Igkv12-46 A C 6: 69,764,536 W112G probably benign Het
Kdelr3 T A 15: 79,525,860 V182E possibly damaging Het
Kif15 T A 9: 122,993,971 N700K probably benign Het
Mycbp2 A T 14: 103,242,432 L1169* probably null Het
Myof A G 19: 37,916,400 Y905H probably damaging Het
Olfr1467 A T 19: 13,365,398 M257L possibly damaging Het
Olfr55 A T 17: 33,176,647 I82F probably damaging Het
Olfr678 A T 7: 105,070,357 T297S probably damaging Het
Otud7b T A 3: 96,153,524 probably null Het
Pde4d T C 13: 109,772,644 C197R probably benign Het
Pde8b T C 13: 95,026,146 T823A probably benign Het
Plekha5 C T 6: 140,551,144 T140M probably damaging Het
Plekhg2 G A 7: 28,362,669 R594W probably damaging Het
Ppp2r1b C T 9: 50,866,928 A315V possibly damaging Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Psg26 A T 7: 18,480,105 S211T probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGT 11: 3,153,384 probably benign Het
Slc5a9 A T 4: 111,893,217 V148E possibly damaging Het
Tex37 C A 6: 70,913,482 A109S possibly damaging Het
Txndc15 T G 13: 55,718,219 N165K probably damaging Het
Zfp493 T C 13: 67,786,318 I130T possibly damaging Het
Other mutations in 4930430A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:4930430A15Rik APN 2 111220762 missense probably damaging 0.98
IGL01403:4930430A15Rik APN 2 111229170 unclassified probably benign
IGL01431:4930430A15Rik APN 2 111225395 unclassified probably benign
IGL01601:4930430A15Rik APN 2 111193478 missense unknown
IGL01649:4930430A15Rik APN 2 111214576 splice site probably benign
IGL02355:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02362:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02485:4930430A15Rik APN 2 111228325 missense probably damaging 0.97
IGL02620:4930430A15Rik APN 2 111211625 missense probably benign 0.00
IGL03156:4930430A15Rik APN 2 111200412 missense possibly damaging 0.90
IGL02980:4930430A15Rik UTSW 2 111164473 missense unknown
R0577:4930430A15Rik UTSW 2 111194349 missense probably benign 0.27
R0638:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R0645:4930430A15Rik UTSW 2 111214583 critical splice donor site probably null
R0671:4930430A15Rik UTSW 2 111204137 missense possibly damaging 0.93
R0829:4930430A15Rik UTSW 2 111198105 missense possibly damaging 0.92
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1486:4930430A15Rik UTSW 2 111200358 missense possibly damaging 0.84
R1509:4930430A15Rik UTSW 2 111218627 missense probably benign
R1672:4930430A15Rik UTSW 2 111220774 missense probably benign 0.00
R2073:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2074:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2075:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2899:4930430A15Rik UTSW 2 111220670 splice site probably benign
R2965:4930430A15Rik UTSW 2 111204019 missense possibly damaging 0.61
R3110:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R3112:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R4489:4930430A15Rik UTSW 2 111220702 missense probably benign 0.31
R4821:4930430A15Rik UTSW 2 111204145 critical splice acceptor site probably null
R4925:4930430A15Rik UTSW 2 111218616 missense probably benign 0.41
R5045:4930430A15Rik UTSW 2 111193459 missense unknown
R5057:4930430A15Rik UTSW 2 111225421 missense probably benign 0.12
R5128:4930430A15Rik UTSW 2 111164329 nonsense probably null
R5250:4930430A15Rik UTSW 2 111228077 missense possibly damaging 0.87
R5333:4930430A15Rik UTSW 2 111194337 missense possibly damaging 0.92
R5677:4930430A15Rik UTSW 2 111211565 missense probably benign
R5722:4930430A15Rik UTSW 2 111204123 missense probably benign
R5735:4930430A15Rik UTSW 2 111225492 nonsense probably null
R6170:4930430A15Rik UTSW 2 111227948 missense probably benign 0.03
R6366:4930430A15Rik UTSW 2 111169592 critical splice donor site probably null
R6496:4930430A15Rik UTSW 2 111164472 missense unknown
R6654:4930430A15Rik UTSW 2 111171884 missense unknown
R6983:4930430A15Rik UTSW 2 111228250 critical splice donor site probably null
R7371:4930430A15Rik UTSW 2 111193481 missense unknown
R7958:4930430A15Rik UTSW 2 111170325 missense unknown
R8421:4930430A15Rik UTSW 2 111218610 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGACTCCAATCAATCTATGGG -3'
(R):5'- ACTACATAGCATGTGTGTTTGTCTG -3'

Sequencing Primer
(F):5'- GGACTCCAATCAATCTATGGGAAATG -3'
(R):5'- CTGGGTTTGGGTTACCTCAC -3'
Posted On2016-08-04