Incidental Mutation 'R5376:Slc5a9'
ID425553
Institutional Source Beutler Lab
Gene Symbol Slc5a9
Ensembl Gene ENSMUSG00000028544
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 9
SynonymsSGLT4
MMRRC Submission 042952-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5376 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location111875375-111902918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111893217 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 148 (V148E)
Ref Sequence ENSEMBL: ENSMUSP00000099782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102719] [ENSMUST00000102720] [ENSMUST00000102721] [ENSMUST00000128340]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102719
AA Change: V148E

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099780
Gene: ENSMUSG00000028544
AA Change: V148E

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102720
AA Change: V148E

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099781
Gene: ENSMUSG00000028544
AA Change: V148E

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102721
AA Change: V148E

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099782
Gene: ENSMUSG00000028544
AA Change: V148E

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000128340
AA Change: V63E

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120546
Gene: ENSMUSG00000028544
AA Change: V63E

DomainStartEndE-ValueType
Pfam:SSF 23 255 9.3e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149922
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,215,599 D286G probably benign Het
Aatk G C 11: 120,012,034 S512W probably damaging Het
Abcc2 A T 19: 43,829,900 N1275I possibly damaging Het
Adgb T C 10: 10,346,563 T1455A probably benign Het
Apopt1 A G 12: 111,730,058 D142G probably damaging Het
Cnnm3 T A 1: 36,520,678 L566H probably damaging Het
Dennd4b C T 3: 90,278,056 P1229L probably benign Het
Dsc1 T G 18: 20,088,446 K657N probably benign Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Eef1d G T 15: 75,903,189 T207N probably benign Het
Eif4g1 T A 16: 20,683,827 Y955N probably damaging Het
Evi5l T C 8: 4,210,770 T1016A probably damaging Het
Fcrl6 G A 1: 172,599,280 T33M probably damaging Het
Golga3 T C 5: 110,220,945 probably null Het
Gpbp1 T C 13: 111,426,642 N425D probably damaging Het
Igkv12-46 A C 6: 69,764,536 W112G probably benign Het
Kdelr3 T A 15: 79,525,860 V182E possibly damaging Het
Kif15 T A 9: 122,993,971 N700K probably benign Het
Mycbp2 A T 14: 103,242,432 L1169* probably null Het
Myof A G 19: 37,916,400 Y905H probably damaging Het
Olfr1467 A T 19: 13,365,398 M257L possibly damaging Het
Olfr55 A T 17: 33,176,647 I82F probably damaging Het
Olfr678 A T 7: 105,070,357 T297S probably damaging Het
Otud7b T A 3: 96,153,524 probably null Het
Pde4d T C 13: 109,772,644 C197R probably benign Het
Pde8b T C 13: 95,026,146 T823A probably benign Het
Plekha5 C T 6: 140,551,144 T140M probably damaging Het
Plekhg2 G A 7: 28,362,669 R594W probably damaging Het
Ppp2r1b C T 9: 50,866,928 A315V possibly damaging Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Psg26 A T 7: 18,480,105 S211T probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGT 11: 3,153,384 probably benign Het
Tex37 C A 6: 70,913,482 A109S possibly damaging Het
Txndc15 T G 13: 55,718,219 N165K probably damaging Het
Zfp493 T C 13: 67,786,318 I130T possibly damaging Het
Other mutations in Slc5a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Slc5a9 APN 4 111898569 missense probably damaging 0.99
IGL00837:Slc5a9 APN 4 111893690 intron probably benign
IGL01556:Slc5a9 APN 4 111898636 missense probably benign 0.00
IGL01807:Slc5a9 APN 4 111877540 makesense probably null
IGL01816:Slc5a9 APN 4 111898614 missense probably damaging 1.00
IGL02066:Slc5a9 APN 4 111887522 missense probably damaging 1.00
IGL02370:Slc5a9 APN 4 111877629 missense probably benign 0.01
IGL02491:Slc5a9 APN 4 111896352 missense probably damaging 0.99
IGL02971:Slc5a9 APN 4 111890300 missense possibly damaging 0.58
IGL03008:Slc5a9 APN 4 111890941 missense probably benign 0.14
R0365:Slc5a9 UTSW 4 111891836 nonsense probably null
R0559:Slc5a9 UTSW 4 111885582 missense probably benign 0.02
R0659:Slc5a9 UTSW 4 111883871 missense possibly damaging 0.82
R1454:Slc5a9 UTSW 4 111883964 missense probably benign 0.04
R2006:Slc5a9 UTSW 4 111880226 missense probably benign
R2014:Slc5a9 UTSW 4 111896349 missense possibly damaging 0.76
R2024:Slc5a9 UTSW 4 111890531 missense probably damaging 1.00
R2076:Slc5a9 UTSW 4 111885573 missense possibly damaging 0.76
R2152:Slc5a9 UTSW 4 111893223 missense possibly damaging 0.76
R3156:Slc5a9 UTSW 4 111890224 missense possibly damaging 0.80
R4566:Slc5a9 UTSW 4 111891744 intron probably null
R4568:Slc5a9 UTSW 4 111891744 intron probably null
R4579:Slc5a9 UTSW 4 111893187 missense probably damaging 1.00
R4656:Slc5a9 UTSW 4 111891744 intron probably null
R4657:Slc5a9 UTSW 4 111891744 intron probably null
R4700:Slc5a9 UTSW 4 111890937 missense possibly damaging 0.64
R4889:Slc5a9 UTSW 4 111891744 intron probably null
R4891:Slc5a9 UTSW 4 111891744 intron probably null
R4911:Slc5a9 UTSW 4 111891744 intron probably null
R4948:Slc5a9 UTSW 4 111891744 intron probably null
R4953:Slc5a9 UTSW 4 111891744 intron probably null
R5222:Slc5a9 UTSW 4 111898611 missense possibly damaging 0.55
R5502:Slc5a9 UTSW 4 111893169 nonsense probably null
R5851:Slc5a9 UTSW 4 111885600 missense probably benign
R6030:Slc5a9 UTSW 4 111885528 missense possibly damaging 0.64
R6030:Slc5a9 UTSW 4 111885528 missense possibly damaging 0.64
R6125:Slc5a9 UTSW 4 111883805 missense probably damaging 1.00
R6326:Slc5a9 UTSW 4 111880253 missense probably benign
R6438:Slc5a9 UTSW 4 111891825 missense probably benign 0.00
R7105:Slc5a9 UTSW 4 111898695 missense probably benign
R7166:Slc5a9 UTSW 4 111883839 missense probably benign 0.04
R7489:Slc5a9 UTSW 4 111883916 missense probably damaging 1.00
R7599:Slc5a9 UTSW 4 111877740 missense probably benign
R7662:Slc5a9 UTSW 4 111877540 makesense probably null
X0012:Slc5a9 UTSW 4 111893314 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCACTCTCTGAGGTCATG -3'
(R):5'- TGCTATCCTTAGGTAGAAAGTTGC -3'

Sequencing Primer
(F):5'- CACTCTCTGAGGTCATGTGGATC -3'
(R):5'- TCCTTAGGTAGAAAGTTGCTCATC -3'
Posted On2016-08-04