Mutagenetix > Incidental Mutation

Incidental Mutation 'R5376:Adgb'

425567

Institutional Source

Beutler Lab

Gene Symbol

Adgb

Ensembl Gene

ENSMUSG00000050994

Gene Name

androglobin

Synonyms

9130014G24Rik

MMRRC Submission

042952-MU

Accession Numbers

MGI:3605549

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5376 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10335703-10472326 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10346563 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1455 (T1455A)

Ref Sequence

ENSEMBL: ENSMUSP00000136386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]

AlphaFold

G3UZ78

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118589

Predicted Effect

probably benign
Transcript: ENSMUST00000148816

SMART Domains

Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
Blast:CysPc	1	41	1e-19	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172530
AA Change: T1452A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: T1452A

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179956
AA Change: T1455A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: T1455A

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208717
AA Change: T1428A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	C	2: 111,215,599	D286G	probably benign	Het
Aatk	G	C	11: 120,012,034	S512W	probably damaging	Het
Abcc2	A	T	19: 43,829,900	N1275I	possibly damaging	Het
Apopt1	A	G	12: 111,730,058	D142G	probably damaging	Het
Cnnm3	T	A	1: 36,520,678	L566H	probably damaging	Het
Dennd4b	C	T	3: 90,278,056	P1229L	probably benign	Het
Dsc1	T	G	18: 20,088,446	K657N	probably benign	Het
Dzip1	C	T	14: 118,911,393	M291I	probably damaging	Het
Eef1d	G	T	15: 75,903,189	T207N	probably benign	Het
Eif4g1	T	A	16: 20,683,827	Y955N	probably damaging	Het
Evi5l	T	C	8: 4,210,770	T1016A	probably damaging	Het
Fcrl6	G	A	1: 172,599,280	T33M	probably damaging	Het
Golga3	T	C	5: 110,220,945		probably null	Het
Gpbp1	T	C	13: 111,426,642	N425D	probably damaging	Het
Igkv12-46	A	C	6: 69,764,536	W112G	probably benign	Het
Kdelr3	T	A	15: 79,525,860	V182E	possibly damaging	Het
Kif15	T	A	9: 122,993,971	N700K	probably benign	Het
Mycbp2	A	T	14: 103,242,432	L1169*	probably null	Het
Myof	A	G	19: 37,916,400	Y905H	probably damaging	Het
Olfr1467	A	T	19: 13,365,398	M257L	possibly damaging	Het
Olfr55	A	T	17: 33,176,647	I82F	probably damaging	Het
Olfr678	A	T	7: 105,070,357	T297S	probably damaging	Het
Otud7b	T	A	3: 96,153,524		probably null	Het
Pde4d	T	C	13: 109,772,644	C197R	probably benign	Het
Pde8b	T	C	13: 95,026,146	T823A	probably benign	Het
Plekha5	C	T	6: 140,551,144	T140M	probably damaging	Het
Plekhg2	G	A	7: 28,362,669	R594W	probably damaging	Het
Ppp2r1b	C	T	9: 50,866,928	A315V	possibly damaging	Het
Psg25	A	T	7: 18,526,535	I146N	probably benign	Het
Psg26	A	T	7: 18,480,105	S211T	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGT	11: 3,153,384		probably benign	Het
Slc5a9	A	T	4: 111,893,217	V148E	possibly damaging	Het
Tex37	C	A	6: 70,913,482	A109S	possibly damaging	Het
Txndc15	T	G	13: 55,718,219	N165K	probably damaging	Het
Zfp493	T	C	13: 67,786,318	I130T	possibly damaging	Het

Other mutations in Adgb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Adgb	APN	10	10406099	missense	possibly damaging	0.87
IGL01083:Adgb	APN	10	10407554	missense	possibly damaging	0.50
IGL03064:Adgb	APN	10	10400572	missense	probably benign	0.02
R0080:Adgb	UTSW	10	10377839	splice site	probably benign
R0084:Adgb	UTSW	10	10396344	missense	possibly damaging	0.74
R0112:Adgb	UTSW	10	10407158	splice site	probably benign
R0348:Adgb	UTSW	10	10357879	missense	probably benign
R0415:Adgb	UTSW	10	10431067	splice site	probably null
R0633:Adgb	UTSW	10	10391729	missense	probably benign	0.36
R1052:Adgb	UTSW	10	10442613	missense	probably benign	0.29
R1248:Adgb	UTSW	10	10395310	missense	probably damaging	0.98
R1278:Adgb	UTSW	10	10382828	missense	probably damaging	1.00
R1568:Adgb	UTSW	10	10442665	nonsense	probably null
R1647:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1648:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1663:Adgb	UTSW	10	10339675	missense	possibly damaging	0.86
R1688:Adgb	UTSW	10	10350317	nonsense	probably null
R1758:Adgb	UTSW	10	10426605	missense	probably damaging	1.00
R1772:Adgb	UTSW	10	10382721	splice site	probably benign
R1850:Adgb	UTSW	10	10442502	missense	probably damaging	1.00
R1959:Adgb	UTSW	10	10395249	missense	probably benign	0.02
R1980:Adgb	UTSW	10	10433498	missense	probably benign
R2179:Adgb	UTSW	10	10395274	missense	possibly damaging	0.94
R2229:Adgb	UTSW	10	10436051	missense	probably damaging	1.00
R2283:Adgb	UTSW	10	10377891	missense	probably damaging	0.99
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2875:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2876:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2920:Adgb	UTSW	10	10390243	missense	probably damaging	1.00
R2931:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R3722:Adgb	UTSW	10	10340510	missense	probably benign	0.32
R3846:Adgb	UTSW	10	10382721	splice site	probably benign
R3877:Adgb	UTSW	10	10442483	critical splice donor site	probably null
R4210:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4211:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4333:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R4448:Adgb	UTSW	10	10390825	missense	probably benign	0.32
R4470:Adgb	UTSW	10	10398951	missense	probably benign	0.02
R4624:Adgb	UTSW	10	10403004	missense	probably benign	0.00
R4656:Adgb	UTSW	10	10405306	missense	probably damaging	0.99
R4676:Adgb	UTSW	10	10426710	missense	probably damaging	1.00
R4792:Adgb	UTSW	10	10398903	missense	probably damaging	0.96
R4795:Adgb	UTSW	10	10357872	missense	probably benign	0.01
R4858:Adgb	UTSW	10	10349577	missense	probably damaging	1.00
R4985:Adgb	UTSW	10	10400632	missense	possibly damaging	0.69
R5057:Adgb	UTSW	10	10357978	missense	probably benign	0.11
R5157:Adgb	UTSW	10	10398966	missense	probably damaging	1.00
R5209:Adgb	UTSW	10	10398937	missense	possibly damaging	0.71
R5339:Adgb	UTSW	10	10442606	missense	probably damaging	1.00
R5426:Adgb	UTSW	10	10350260	missense	probably benign	0.14
R5516:Adgb	UTSW	10	10431157	missense	probably damaging	1.00
R5554:Adgb	UTSW	10	10340473	missense	probably damaging	0.98
R5678:Adgb	UTSW	10	10431326	missense	possibly damaging	0.83
R5707:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5708:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5891:Adgb	UTSW	10	10377847	nonsense	probably null
R5928:Adgb	UTSW	10	10378787	missense	probably damaging	1.00
R6005:Adgb	UTSW	10	10395352	missense	probably damaging	1.00
R6017:Adgb	UTSW	10	10450036	missense	probably damaging	1.00
R6049:Adgb	UTSW	10	10378026	missense	probably damaging	1.00
R6118:Adgb	UTSW	10	10431291	missense	probably damaging	1.00
R6175:Adgb	UTSW	10	10398943	missense	possibly damaging	0.94
R6186:Adgb	UTSW	10	10422758	missense	probably damaging	1.00
R6234:Adgb	UTSW	10	10353080	splice site	probably null
R6383:Adgb	UTSW	10	10450028	missense	probably damaging	1.00
R6522:Adgb	UTSW	10	10377892	nonsense	probably null
R6639:Adgb	UTSW	10	10435956	missense	possibly damaging	0.51
R6697:Adgb	UTSW	10	10406126	nonsense	probably null
R6742:Adgb	UTSW	10	10411849	missense	probably damaging	1.00
R6745:Adgb	UTSW	10	10390197	missense	probably damaging	1.00
R6850:Adgb	UTSW	10	10394574	missense	probably benign	0.39
R7128:Adgb	UTSW	10	10472241	missense	probably benign	0.26
R7326:Adgb	UTSW	10	10400574	missense	possibly damaging	0.80
R7386:Adgb	UTSW	10	10377949	missense	possibly damaging	0.52
R7431:Adgb	UTSW	10	10391955	splice site	probably null
R7569:Adgb	UTSW	10	10431252	missense	probably benign
R7579:Adgb	UTSW	10	10410818	nonsense	probably null
R7582:Adgb	UTSW	10	10390821	missense	probably damaging	1.00
R7615:Adgb	UTSW	10	10436010	missense	probably damaging	0.96
R7692:Adgb	UTSW	10	10411712	critical splice donor site	probably null
R7774:Adgb	UTSW	10	10339660	nonsense	probably null
R7808:Adgb	UTSW	10	10378659	splice site	probably null
R8158:Adgb	UTSW	10	10378734	missense	probably benign	0.22
R8386:Adgb	UTSW	10	10350304	missense	probably damaging	1.00
R8746:Adgb	UTSW	10	10405284	critical splice donor site	probably null
R8785:Adgb	UTSW	10	10357966	missense	probably damaging	1.00
R9089:Adgb	UTSW	10	10442688	missense	probably benign	0.26
R9140:Adgb	UTSW	10	10340519	nonsense	probably null
R9386:Adgb	UTSW	10	10398964	missense	probably benign	0.00
R9777:Adgb	UTSW	10	10407470	missense	possibly damaging	0.74
X0003:Adgb	UTSW	10	10394630	missense	possibly damaging	0.76
Z1176:Adgb	UTSW	10	10378742	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TACCTTACCAGCAGGATCAGGAC -3'
(R):5'- ACCTCACACTTGGCCTACAG -3'

Sequencing Primer
(F):5'- AGGACTCACCAGGGATCTCCTTC -3'
(R):5'- TTGGCCTACAGTAACTATATCACAC -3'

Posted On

2016-08-04