Incidental Mutation 'R5376:Txndc15'
ID425571
Institutional Source Beutler Lab
Gene Symbol Txndc15
Ensembl Gene ENSMUSG00000021497
Gene Namethioredoxin domain containing 15
Synonyms
MMRRC Submission 042952-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5376 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55714650-55726227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 55718219 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 165 (N165K)
Ref Sequence ENSEMBL: ENSMUSP00000021959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021959]
Predicted Effect probably damaging
Transcript: ENSMUST00000021959
AA Change: N165K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021959
Gene: ENSMUSG00000021497
AA Change: N165K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 174 278 8.6e-11 PFAM
transmembrane domain 305 324 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223649
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,215,599 D286G probably benign Het
Aatk G C 11: 120,012,034 S512W probably damaging Het
Abcc2 A T 19: 43,829,900 N1275I possibly damaging Het
Adgb T C 10: 10,346,563 T1455A probably benign Het
Apopt1 A G 12: 111,730,058 D142G probably damaging Het
Cnnm3 T A 1: 36,520,678 L566H probably damaging Het
Dennd4b C T 3: 90,278,056 P1229L probably benign Het
Dsc1 T G 18: 20,088,446 K657N probably benign Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Eef1d G T 15: 75,903,189 T207N probably benign Het
Eif4g1 T A 16: 20,683,827 Y955N probably damaging Het
Evi5l T C 8: 4,210,770 T1016A probably damaging Het
Fcrl6 G A 1: 172,599,280 T33M probably damaging Het
Golga3 T C 5: 110,220,945 probably null Het
Gpbp1 T C 13: 111,426,642 N425D probably damaging Het
Igkv12-46 A C 6: 69,764,536 W112G probably benign Het
Kdelr3 T A 15: 79,525,860 V182E possibly damaging Het
Kif15 T A 9: 122,993,971 N700K probably benign Het
Mycbp2 A T 14: 103,242,432 L1169* probably null Het
Myof A G 19: 37,916,400 Y905H probably damaging Het
Olfr1467 A T 19: 13,365,398 M257L possibly damaging Het
Olfr55 A T 17: 33,176,647 I82F probably damaging Het
Olfr678 A T 7: 105,070,357 T297S probably damaging Het
Otud7b T A 3: 96,153,524 probably null Het
Pde4d T C 13: 109,772,644 C197R probably benign Het
Pde8b T C 13: 95,026,146 T823A probably benign Het
Plekha5 C T 6: 140,551,144 T140M probably damaging Het
Plekhg2 G A 7: 28,362,669 R594W probably damaging Het
Ppp2r1b C T 9: 50,866,928 A315V possibly damaging Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Psg26 A T 7: 18,480,105 S211T probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGT 11: 3,153,384 probably benign Het
Slc5a9 A T 4: 111,893,217 V148E possibly damaging Het
Tex37 C A 6: 70,913,482 A109S possibly damaging Het
Zfp493 T C 13: 67,786,318 I130T possibly damaging Het
Other mutations in Txndc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Txndc15 APN 13 55725675 missense probably damaging 1.00
IGL01634:Txndc15 APN 13 55721625 missense probably damaging 0.99
PIT4791001:Txndc15 UTSW 13 55721694 missense probably benign 0.39
R0309:Txndc15 UTSW 13 55724582 missense probably damaging 1.00
R0480:Txndc15 UTSW 13 55724623 missense possibly damaging 0.91
R1473:Txndc15 UTSW 13 55721574 splice site probably benign
R1856:Txndc15 UTSW 13 55718062 missense possibly damaging 0.80
R4456:Txndc15 UTSW 13 55718164 missense possibly damaging 0.82
R4945:Txndc15 UTSW 13 55718165 missense probably benign 0.01
R5159:Txndc15 UTSW 13 55717921 missense probably benign
R5776:Txndc15 UTSW 13 55718107 missense probably benign 0.01
R7365:Txndc15 UTSW 13 55714788 missense unknown
R7392:Txndc15 UTSW 13 55721586 missense probably damaging 1.00
R7557:Txndc15 UTSW 13 55717954 missense probably benign 0.05
R7679:Txndc15 UTSW 13 55725808 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCATGAAGAGGAGGTTGCTC -3'
(R):5'- TGGAGACCAACCTGGACAAC -3'

Sequencing Primer
(F):5'- AGGAGGTTGCTCAGGACCATC -3'
(R):5'- CATCCATCCGAAAGCTGATGAG -3'
Posted On2016-08-04