Incidental Mutation 'R0492:Dhx38'
ID 42559
Institutional Source Beutler Lab
Gene Symbol Dhx38
Ensembl Gene ENSMUSG00000037993
Gene Name DEAH-box helicase 38
Synonyms Ddx38, 5730550P09Rik, Prp16
MMRRC Submission 038690-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R0492 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 110274643-110292493 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 110288576 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034159] [ENSMUST00000042601]
AlphaFold Q80X98
Predicted Effect probably benign
Transcript: ENSMUST00000034159
SMART Domains Protein: ENSMUSP00000034159
Gene: ENSMUSG00000031723

DomainStartEndE-ValueType
Pfam:DIM1 4 136 1.6e-58 PFAM
Pfam:Thioredoxin 6 109 3.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042601
SMART Domains Protein: ENSMUSP00000047865
Gene: ENSMUSG00000037993

DomainStartEndE-ValueType
Blast:DEXDc 3 146 2e-46 BLAST
low complexity region 147 204 N/A INTRINSIC
Blast:DEXDc 205 444 1e-105 BLAST
low complexity region 511 525 N/A INTRINSIC
DEXDc 531 715 6.88e-34 SMART
HELICc 759 862 1.11e-19 SMART
HA2 923 1013 3.22e-32 SMART
low complexity region 1163 1194 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD/H box family of splicing factors. This protein resembles yeast Prp16 more closely than other DEAD/H family members. It is an ATPase and essential for the catalytic step II in pre-mRNA splicing process. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 C G 4: 129,901,624 (GRCm39) P416R probably damaging Het
Adgre1 A G 17: 57,709,742 (GRCm39) D133G unknown Het
Alpl A C 4: 137,476,887 (GRCm39) probably null Het
Ankrd65 T C 4: 155,875,133 (GRCm39) probably benign Het
Baalc A T 15: 38,797,480 (GRCm39) probably benign Het
Bpifb5 A G 2: 154,070,820 (GRCm39) T204A probably benign Het
Bud31 A G 5: 145,083,265 (GRCm39) Y77C probably damaging Het
Calhm6 G A 10: 34,003,647 (GRCm39) R87* probably null Het
Capsl A G 15: 9,461,930 (GRCm39) probably benign Het
Ccna1 A G 3: 54,956,004 (GRCm39) V116A probably damaging Het
Cdc42bpa C A 1: 179,928,755 (GRCm39) H723N probably benign Het
Cfap161 T C 7: 83,443,245 (GRCm39) I40V possibly damaging Het
CK137956 C T 4: 127,845,093 (GRCm39) V217I probably benign Het
Cog5 A G 12: 31,919,460 (GRCm39) T540A probably damaging Het
Cps1 T C 1: 67,196,995 (GRCm39) W349R probably damaging Het
Crispld2 G T 8: 120,752,806 (GRCm39) V285L probably benign Het
Crtc2 T A 3: 90,170,804 (GRCm39) F626I probably damaging Het
Daam1 G A 12: 71,991,154 (GRCm39) R256H unknown Het
Dok4 G A 8: 95,591,764 (GRCm39) A324V probably benign Het
Dscam T C 16: 96,626,982 (GRCm39) probably null Het
Dusp16 A T 6: 134,695,365 (GRCm39) S489T probably benign Het
Ecpas A G 4: 58,864,418 (GRCm39) W288R probably damaging Het
Erbin A T 13: 103,970,866 (GRCm39) Y917N probably damaging Het
F13b A T 1: 139,450,297 (GRCm39) probably null Het
Fdx1 C A 9: 51,874,725 (GRCm39) A15S probably benign Het
Ffar4 A T 19: 38,085,630 (GRCm39) Q19L probably benign Het
Folh1 A C 7: 86,395,400 (GRCm39) V344G probably damaging Het
Fscb T A 12: 64,520,292 (GRCm39) E391D possibly damaging Het
Gigyf2 G A 1: 87,368,568 (GRCm39) G1083R probably damaging Het
Gm14403 C A 2: 177,200,359 (GRCm39) H102N probably benign Het
Gm4847 A G 1: 166,457,961 (GRCm39) F464S probably damaging Het
Gpam A T 19: 55,084,611 (GRCm39) M56K possibly damaging Het
Gpr165 T A X: 95,760,778 (GRCm39) F352I probably damaging Het
Grik2 T G 10: 48,977,260 (GRCm39) I891L probably damaging Het
Gsr T C 8: 34,171,603 (GRCm39) probably benign Het
Hhla1 A G 15: 65,808,140 (GRCm39) F302L probably benign Het
Impg1 T C 9: 80,252,590 (GRCm39) D453G possibly damaging Het
Inpp5d T A 1: 87,625,872 (GRCm39) V495E possibly damaging Het
Iqca1l A T 5: 24,759,626 (GRCm39) L48Q probably damaging Het
Iqce A T 5: 140,660,990 (GRCm39) L450H probably damaging Het
Itfg2 A G 6: 128,390,486 (GRCm39) probably null Het
Kif13a A G 13: 46,966,218 (GRCm39) V400A possibly damaging Het
Kif7 T C 7: 79,363,629 (GRCm39) Y93C probably damaging Het
Krt33a A G 11: 99,906,909 (GRCm39) V22A probably benign Het
Lct T C 1: 128,228,319 (GRCm39) D1058G probably damaging Het
Lrp6 G T 6: 134,457,481 (GRCm39) D774E possibly damaging Het
Lrrc9 T A 12: 72,525,537 (GRCm39) S828R possibly damaging Het
Ly75 A G 2: 60,138,620 (GRCm39) W1416R probably damaging Het
Mdh2 T C 5: 135,819,004 (GRCm39) I320T possibly damaging Het
Med13l T A 5: 118,876,560 (GRCm39) V912E probably damaging Het
Mgarp T C 3: 51,296,456 (GRCm39) D182G possibly damaging Het
Mllt10 T C 2: 18,151,698 (GRCm39) probably benign Het
Mmp28 G A 11: 83,334,629 (GRCm39) A375V probably damaging Het
Mrps23 T A 11: 88,101,511 (GRCm39) H133Q probably benign Het
Msh6 T C 17: 88,282,679 (GRCm39) S35P probably benign Het
Myo3a A G 2: 22,328,447 (GRCm39) D347G possibly damaging Het
Npc1l1 T C 11: 6,173,040 (GRCm39) K800E possibly damaging Het
Or2ag13 A T 7: 106,473,084 (GRCm39) Y123N probably damaging Het
Or51ai2 T C 7: 103,586,971 (GRCm39) I128T probably benign Het
Or5i1 T G 2: 87,613,166 (GRCm39) I94S probably damaging Het
Or5m9 T C 2: 85,876,931 (GRCm39) V35A probably benign Het
Or5m9 T C 2: 85,877,278 (GRCm39) F151L possibly damaging Het
Or5t7 G A 2: 86,506,834 (GRCm39) P281L probably damaging Het
Or6p1 T A 1: 174,258,129 (GRCm39) I45N possibly damaging Het
Osmr A C 15: 6,853,999 (GRCm39) W570G probably damaging Het
Otol1 A T 3: 69,935,117 (GRCm39) I370F probably damaging Het
Pank2 A G 2: 131,122,180 (GRCm39) Y235C probably damaging Het
Pias2 T C 18: 77,193,581 (GRCm39) S187P probably damaging Het
Pkhd1l1 A G 15: 44,383,086 (GRCm39) N1115S probably benign Het
Pld1 G T 3: 28,163,966 (GRCm39) A800S probably damaging Het
Prex2 T C 1: 11,256,857 (GRCm39) probably benign Het
Ptpn3 T C 4: 57,194,304 (GRCm39) Q908R probably benign Het
Rab3gap2 T A 1: 184,984,589 (GRCm39) probably benign Het
Rbm24 A T 13: 46,573,826 (GRCm39) N82Y probably damaging Het
Rpl27 T C 11: 101,336,081 (GRCm39) V47A possibly damaging Het
Serpina1f A G 12: 103,659,826 (GRCm39) V152A possibly damaging Het
Serpina5 A G 12: 104,068,392 (GRCm39) Y151C probably damaging Het
Serpinb7 A G 1: 107,379,737 (GRCm39) *381W probably null Het
Sh2b2 A G 5: 136,261,117 (GRCm39) F33S probably damaging Het
Slc22a2 A C 17: 12,834,159 (GRCm39) I476L probably benign Het
Slc6a12 A T 6: 121,332,331 (GRCm39) I222F probably benign Het
Smim26 G A 2: 144,437,033 (GRCm39) D61N probably damaging Het
Soat1 A T 1: 156,268,924 (GRCm39) Y209N probably benign Het
Sorl1 T C 9: 41,902,667 (GRCm39) H1630R probably null Het
Sptlc2 A T 12: 87,393,580 (GRCm39) probably null Het
Strn3 G A 12: 51,657,187 (GRCm39) T642I probably damaging Het
Syce1l T A 8: 114,380,700 (GRCm39) D137E possibly damaging Het
Syne2 T C 12: 76,028,837 (GRCm39) probably null Het
Tcf25 C A 8: 124,108,203 (GRCm39) P86Q probably benign Het
Tmem19 A T 10: 115,197,715 (GRCm39) Y43* probably null Het
Tmem30b T C 12: 73,592,942 (GRCm39) N58D probably benign Het
Tnn A C 1: 159,948,327 (GRCm39) I795M probably damaging Het
Tnpo1 A G 13: 98,991,954 (GRCm39) Y641H probably damaging Het
Tra2a A T 6: 49,227,889 (GRCm39) probably benign Het
Trappc8 A T 18: 20,999,243 (GRCm39) F295I probably benign Het
Vmn2r101 T A 17: 19,809,245 (GRCm39) W125R probably damaging Het
Vps8 C A 16: 21,261,107 (GRCm39) F82L probably damaging Het
Ythdf2 A T 4: 131,931,779 (GRCm39) S460R probably damaging Het
Other mutations in Dhx38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Dhx38 APN 8 110,283,566 (GRCm39) missense possibly damaging 0.49
IGL00821:Dhx38 APN 8 110,282,286 (GRCm39) missense probably benign 0.00
IGL00910:Dhx38 APN 8 110,285,666 (GRCm39) missense probably benign 0.07
IGL01011:Dhx38 APN 8 110,289,323 (GRCm39) missense probably benign
IGL01401:Dhx38 APN 8 110,278,746 (GRCm39) missense probably benign 0.15
IGL02133:Dhx38 APN 8 110,284,873 (GRCm39) nonsense probably null
IGL02529:Dhx38 APN 8 110,285,645 (GRCm39) missense probably benign 0.00
IGL02652:Dhx38 APN 8 110,282,761 (GRCm39) missense probably damaging 1.00
IGL03241:Dhx38 APN 8 110,289,288 (GRCm39) missense possibly damaging 0.47
IGL03378:Dhx38 APN 8 110,285,722 (GRCm39) splice site probably null
R0358:Dhx38 UTSW 8 110,279,094 (GRCm39) missense probably benign 0.13
R0375:Dhx38 UTSW 8 110,281,813 (GRCm39) missense possibly damaging 0.89
R0437:Dhx38 UTSW 8 110,285,261 (GRCm39) splice site probably benign
R0481:Dhx38 UTSW 8 110,282,848 (GRCm39) splice site probably benign
R0528:Dhx38 UTSW 8 110,289,293 (GRCm39) missense probably benign 0.00
R0607:Dhx38 UTSW 8 110,285,575 (GRCm39) missense probably benign 0.07
R1638:Dhx38 UTSW 8 110,280,177 (GRCm39) missense probably damaging 1.00
R2020:Dhx38 UTSW 8 110,283,501 (GRCm39) splice site probably benign
R2056:Dhx38 UTSW 8 110,289,352 (GRCm39) unclassified probably benign
R2096:Dhx38 UTSW 8 110,280,891 (GRCm39) missense probably damaging 1.00
R2152:Dhx38 UTSW 8 110,287,306 (GRCm39) missense probably benign 0.00
R2154:Dhx38 UTSW 8 110,287,306 (GRCm39) missense probably benign 0.00
R2382:Dhx38 UTSW 8 110,282,772 (GRCm39) missense probably damaging 0.99
R4367:Dhx38 UTSW 8 110,279,763 (GRCm39) missense probably damaging 1.00
R4368:Dhx38 UTSW 8 110,279,763 (GRCm39) missense probably damaging 1.00
R4369:Dhx38 UTSW 8 110,279,763 (GRCm39) missense probably damaging 1.00
R5250:Dhx38 UTSW 8 110,283,152 (GRCm39) missense probably damaging 1.00
R5354:Dhx38 UTSW 8 110,282,378 (GRCm39) missense probably damaging 1.00
R5668:Dhx38 UTSW 8 110,280,048 (GRCm39) missense probably damaging 1.00
R5777:Dhx38 UTSW 8 110,283,534 (GRCm39) missense possibly damaging 0.81
R5784:Dhx38 UTSW 8 110,286,245 (GRCm39) nonsense probably null
R6799:Dhx38 UTSW 8 110,279,834 (GRCm39) missense probably damaging 1.00
R6915:Dhx38 UTSW 8 110,286,231 (GRCm39) missense probably benign 0.15
R6932:Dhx38 UTSW 8 110,279,307 (GRCm39) missense probably damaging 1.00
R7042:Dhx38 UTSW 8 110,283,617 (GRCm39) missense possibly damaging 0.55
R7248:Dhx38 UTSW 8 110,285,559 (GRCm39) missense probably benign 0.15
R7394:Dhx38 UTSW 8 110,283,155 (GRCm39) missense probably damaging 1.00
R7513:Dhx38 UTSW 8 110,287,221 (GRCm39) missense probably benign 0.00
R7569:Dhx38 UTSW 8 110,287,327 (GRCm39) missense probably damaging 0.98
R8003:Dhx38 UTSW 8 110,282,772 (GRCm39) missense probably damaging 0.99
R8071:Dhx38 UTSW 8 110,285,333 (GRCm39) missense probably benign 0.10
R8537:Dhx38 UTSW 8 110,280,012 (GRCm39) missense probably damaging 1.00
R8852:Dhx38 UTSW 8 110,289,361 (GRCm39) nonsense probably null
R8860:Dhx38 UTSW 8 110,289,361 (GRCm39) nonsense probably null
R8937:Dhx38 UTSW 8 110,283,098 (GRCm39) missense probably damaging 0.96
R9099:Dhx38 UTSW 8 110,282,783 (GRCm39) missense probably damaging 1.00
Z1177:Dhx38 UTSW 8 110,282,717 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACACTCAAGCAAAGTTGCTGTCC -3'
(R):5'- TGTTTCAGGCATTACCGATCTGCTC -3'

Sequencing Primer
(F):5'- GTCCTACAAGAGAGGTATCGTTCC -3'
(R):5'- TCGGGTAGAGACTCCGTC -3'
Posted On 2013-05-23