Mutagenetix > Incidental Mutations

Incidental Mutation 'R5377:Adcy10'

425596

Institutional Source

Beutler Lab

Gene Symbol

Adcy10

Ensembl Gene

ENSMUSG00000026567

Gene Name

adenylate cyclase 10

Synonyms

sAC, Sacy, soluble adenylyl cyclase

MMRRC Submission

042845-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.261) question?

Stock #

R5377 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

165485183-165576774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 165519895 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 393 (C393Y)

Ref Sequence

ENSEMBL: ENSMUSP00000137959 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027852
AA Change: C393Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: C393Y

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	285	442	2.3e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	6e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000111439
AA Change: C393Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: C393Y

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	286	420	1.9e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	7e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000111440
AA Change: C393Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: C393Y

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	286	420	1.9e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	7e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000148550
AA Change: C393Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: C393Y

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	285	420	4.3e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155216

SMART Domains

Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

Domain	Start	End	E-Value	Type
PDB:4OZ3\|A	1	98	2e-51	PDB
Blast:CYCc	7	98	2e-61	BLAST
SCOP:d1azsb_	43	98	9e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194554

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195194

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,645,253	V372F	probably benign	Het
Adgrg7	A	C	16: 56,730,306	I681S	possibly damaging	Het
Akap8l	T	C	17: 32,321,511		probably benign	Het
Akr1a1	A	T	4: 116,639,895	V156E	probably damaging	Het
Alk	T	G	17: 71,895,739	D1167A	probably damaging	Het
Ankrd11	T	C	8: 122,893,714		probably null	Het
Aspm	T	A	1: 139,457,483	N288K	probably damaging	Het
Aspm	A	G	1: 139,470,395		probably null	Het
Asxl2	G	A	12: 3,474,618		probably null	Het
Atp6v0a1	A	G	11: 101,055,587	H802R	probably damaging	Het
B4galnt1	A	G	10: 127,171,822	T531A	possibly damaging	Het
Ccdc114	C	T	7: 45,942,082	R257*	probably null	Het
Cecr2	A	G	6: 120,756,569	N506D	possibly damaging	Het
Crebrf	T	C	17: 26,759,865	V509A	probably damaging	Het
Cyp4f40	A	T	17: 32,675,616	I413F	probably null	Het
Defb12	C	A	8: 19,114,326		probably null	Het
Dnah2	T	C	11: 69,421,848	E4297G	probably damaging	Het
Dpysl5	A	T	5: 30,791,513	N371Y	probably damaging	Het
Eef1d	G	T	15: 75,903,189	T207N	probably benign	Het
Esrrb	C	T	12: 86,519,009	Q416*	probably null	Het
Exd2	T	C	12: 80,489,448	L284P	probably damaging	Het
Fat3	T	A	9: 16,376,443	I595F	probably benign	Het
Gm9920	A	G	15: 55,108,975		probably benign	Het
Hephl1	T	C	9: 15,069,788	K783E	probably damaging	Het
Irs2	A	G	8: 11,005,277	S1052P	probably benign	Het
Kctd18	T	C	1: 57,963,093	I192V	probably benign	Het
Lama3	A	G	18: 12,453,746	D722G	probably damaging	Het
Lepr	T	C	4: 101,815,019	V1080A	possibly damaging	Het
Lpin1	C	T	12: 16,563,655	G504S	probably damaging	Het
Lrit2	A	C	14: 37,069,183	Q273P	possibly damaging	Het
Mgea5	A	T	19: 45,758,022	Y779*	probably null	Het
Mlkl	T	A	8: 111,327,937	E189D	probably benign	Het
Mttp	C	T	3: 138,105,029	R608H	probably benign	Het
Nav2	T	C	7: 49,589,160	V2011A	probably benign	Het
Nos2	A	T	11: 78,957,491	I1075F	probably benign	Het
Npat	A	G	9: 53,550,036		probably null	Het
Nucks1	T	C	1: 131,919,033	F16L	probably damaging	Het
Nus1	T	C	10: 52,429,213	S150P	possibly damaging	Het
Olfr1230	G	T	2: 89,297,162	T36K	probably damaging	Het
Olfr881	A	T	9: 37,992,612	Y40F	probably benign	Het
Pclo	A	G	5: 14,681,353	T3290A	unknown	Het
Pign	A	T	1: 105,657,812	F4Y	probably benign	Het
Rfx4	A	G	10: 84,860,542	N233D	possibly damaging	Het
Rpgrip1	A	T	14: 52,160,195	M1325L	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Scaf11	T	A	15: 96,417,120	H1227L	possibly damaging	Het
Sec31b	G	T	19: 44,518,637	P840T	probably damaging	Het
Slc16a9	T	A	10: 70,283,128	L426I	probably damaging	Het
Slc17a2	T	C	13: 23,812,592	S27P	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Tacc1	A	G	8: 25,182,283	S310P	possibly damaging	Het
Tmem245	G	A	4: 56,947,084	R110C	probably damaging	Het
Trip12	T	C	1: 84,757,431	Y953C	probably damaging	Het
Trpm7	C	A	2: 126,842,855		probably null	Het
Ush2a	G	A	1: 188,912,123	V4561I	probably benign	Het
Vmn1r192	C	T	13: 22,187,631	V140I	probably benign	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	T	C	17: 19,379,269	V405A	probably damaging	Het
Wdhd1	A	C	14: 47,272,221	V172G	probably benign	Het
Zfhx3	C	T	8: 108,951,185	R2956C	possibly damaging	Het
Zfp446	T	C	7: 12,982,251	L283P	possibly damaging	Het
Zfp82	T	C	7: 30,057,166	K164E	probably damaging	Het

Other mutations in Adcy10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00566:Adcy10	APN	1	165551914	missense	probably benign	0.45
IGL00731:Adcy10	APN	1	165572614	missense	probably benign
IGL01099:Adcy10	APN	1	165539842	missense	probably benign	0.21
IGL01464:Adcy10	APN	1	165546587	missense	probably damaging	1.00
IGL01729:Adcy10	APN	1	165513168	critical splice donor site	probably null
IGL02002:Adcy10	APN	1	165521843	missense	probably damaging	1.00
IGL02094:Adcy10	APN	1	165570620	missense	probably damaging	1.00
IGL02132:Adcy10	APN	1	165572543	missense	probably damaging	0.96
IGL02276:Adcy10	APN	1	165559128	missense	probably damaging	0.96
IGL02408:Adcy10	APN	1	165538380	missense	probably damaging	1.00
IGL02410:Adcy10	APN	1	165510408	missense	probably damaging	1.00
IGL02445:Adcy10	APN	1	165570744	missense	possibly damaging	0.85
IGL02470:Adcy10	APN	1	165567726	missense	probably damaging	1.00
IGL02551:Adcy10	APN	1	165543233	missense	probably damaging	1.00
IGL02606:Adcy10	APN	1	165519518	missense	possibly damaging	0.88
IGL02609:Adcy10	APN	1	165538475	nonsense	probably null
Bugged	UTSW	1	165564237	missense	probably damaging	0.99
debye	UTSW	1	165551361	critical splice donor site	probably null
PIT4514001:Adcy10	UTSW	1	165556791	missense	probably benign	0.28
R0046:Adcy10	UTSW	1	165539834	missense	probably damaging	0.99
R0046:Adcy10	UTSW	1	165539834	missense	probably damaging	0.99
R0276:Adcy10	UTSW	1	165572591	missense	possibly damaging	0.88
R0324:Adcy10	UTSW	1	165564249	missense	probably benign	0.00
R0433:Adcy10	UTSW	1	165552022	missense	probably damaging	1.00
R0454:Adcy10	UTSW	1	165570728	missense	probably damaging	1.00
R0501:Adcy10	UTSW	1	165510390	missense	probably damaging	1.00
R0513:Adcy10	UTSW	1	165519519	missense	probably benign	0.04
R0533:Adcy10	UTSW	1	165564023	missense	probably benign	0.05
R0550:Adcy10	UTSW	1	165565315	missense	probably benign	0.00
R0554:Adcy10	UTSW	1	165513130	missense	probably benign
R0597:Adcy10	UTSW	1	165525062	critical splice donor site	probably null
R0629:Adcy10	UTSW	1	165543105	missense	probably damaging	1.00
R1421:Adcy10	UTSW	1	165563947	missense	probably damaging	0.98
R1454:Adcy10	UTSW	1	165515380	missense	possibly damaging	0.66
R1524:Adcy10	UTSW	1	165518403	missense	probably damaging	1.00
R1534:Adcy10	UTSW	1	165518312	missense	probably damaging	0.98
R1594:Adcy10	UTSW	1	165525033	missense	probably benign	0.02
R1690:Adcy10	UTSW	1	165519925	missense	probably damaging	1.00
R1842:Adcy10	UTSW	1	165503243	missense	probably damaging	1.00
R1859:Adcy10	UTSW	1	165521961	missense	probably damaging	1.00
R1885:Adcy10	UTSW	1	165570808	missense	probably benign	0.02
R1929:Adcy10	UTSW	1	165510297	missense	probably damaging	1.00
R2005:Adcy10	UTSW	1	165525022	missense	probably benign	0.02
R2211:Adcy10	UTSW	1	165518212	missense	probably damaging	1.00
R2225:Adcy10	UTSW	1	165518260	missense	probably damaging	1.00
R2227:Adcy10	UTSW	1	165518260	missense	probably damaging	1.00
R2272:Adcy10	UTSW	1	165510297	missense	probably damaging	1.00
R2421:Adcy10	UTSW	1	165558597	missense	probably damaging	0.97
R3614:Adcy10	UTSW	1	165575727	missense	probably benign	0.38
R4538:Adcy10	UTSW	1	165513127	missense	probably benign	0.38
R4644:Adcy10	UTSW	1	165551361	critical splice donor site	probably null
R4649:Adcy10	UTSW	1	165504049	missense	probably damaging	1.00
R4832:Adcy10	UTSW	1	165506644	missense	probably damaging	1.00
R4853:Adcy10	UTSW	1	165548213	missense	probably benign
R4916:Adcy10	UTSW	1	165518246	missense	probably damaging	1.00
R4951:Adcy10	UTSW	1	165563963	missense	probably damaging	1.00
R4972:Adcy10	UTSW	1	165556862	missense	probably damaging	1.00
R5116:Adcy10	UTSW	1	165519500	missense	probably damaging	1.00
R5442:Adcy10	UTSW	1	165513140	missense	probably benign	0.43
R5692:Adcy10	UTSW	1	165515306	missense	probably benign	0.36
R5949:Adcy10	UTSW	1	165539817	missense	possibly damaging	0.79
R5998:Adcy10	UTSW	1	165541649	missense	probably benign	0.19
R6238:Adcy10	UTSW	1	165575728	nonsense	probably null
R6455:Adcy10	UTSW	1	165518374	missense	probably damaging	1.00
R6920:Adcy10	UTSW	1	165575658	missense	probably damaging	1.00
R6935:Adcy10	UTSW	1	165506635	missense	probably benign	0.21
R6957:Adcy10	UTSW	1	165564285	missense	probably damaging	1.00
R6970:Adcy10	UTSW	1	165556916	missense	probably benign	0.02
R7027:Adcy10	UTSW	1	165518246	missense	probably damaging	1.00
R7049:Adcy10	UTSW	1	165539874	missense	probably damaging	1.00
R7062:Adcy10	UTSW	1	165538522	missense	probably benign	0.27
R7130:Adcy10	UTSW	1	165504047	missense	probably damaging	1.00
R7144:Adcy10	UTSW	1	165510370	missense	probably benign	0.01
R7182:Adcy10	UTSW	1	165543470	splice site	probably null
R7228:Adcy10	UTSW	1	165510272	missense	probably damaging	1.00
R7384:Adcy10	UTSW	1	165576608	missense	unknown
R7561:Adcy10	UTSW	1	165559172	missense	possibly damaging	0.94
R7603:Adcy10	UTSW	1	165564237	missense	probably damaging	0.99
R7693:Adcy10	UTSW	1	165570771	missense	probably benign	0.01
R7812:Adcy10	UTSW	1	165515369	missense	probably damaging	1.00
R7905:Adcy10	UTSW	1	165513168	critical splice donor site	probably null
R8040:Adcy10	UTSW	1	165552024	missense	probably damaging	1.00
R8242:Adcy10	UTSW	1	165546549	missense	possibly damaging	0.82
R8278:Adcy10	UTSW	1	165503288	missense	probably damaging	1.00
R8282:Adcy10	UTSW	1	165510337	missense	probably benign	0.34
RF018:Adcy10	UTSW	1	165552109	missense	probably damaging	1.00
Z1177:Adcy10	UTSW	1	165510276	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- ACTTGGTTTGGGCTTCAAGC -3'
(R):5'- TTTGCTCCACCTGGAAAGAC -3'

Sequencing Primer
(F):5'- ATAACTGTCCTAGGCTGAGCATG -3'
(R):5'- CTATAAACTCTCTGAGAACGGAGTC -3'

Posted On

2016-08-04