Mutagenetix > Incidental Mutation

Incidental Mutation 'R5377:Mttp'

425601

Institutional Source

Beutler Lab

Gene Symbol

Mttp

Ensembl Gene

ENSMUSG00000028158

Gene Name

microsomal triglyceride transfer protein

Synonyms

1810043K16Rik, MTP

MMRRC Submission

042845-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.897) question?

Stock #

R5377 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

138089854-138144968 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 138105029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 608 (R608H)

Ref Sequence

ENSEMBL: ENSMUSP00000096179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029805] [ENSMUST00000098580]

AlphaFold

O08601

Predicted Effect

probably benign
Transcript: ENSMUST00000029805
AA Change: R593H

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000029805
Gene: ENSMUSG00000028158
AA Change: R593H

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
LPD_N	28	579	8.87e-165	SMART
Blast:LPD_N	582	695	4e-58	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000098580
AA Change: R608H

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000096179
Gene: ENSMUSG00000028158
AA Change: R608H

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
LPD_N	43	594	8.87e-165	SMART
Blast:LPD_N	597	710	6e-58	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196625

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a reporter allele die at midgestation displaying delayed growth, neurodevelopmental anomalies, impaired erythropoiesis, deficient yolk sac lipoprotein production, hemorrhage and necrosis. Heterozygous mutant mice display altered plasma lipid and lipoprotein profiles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,645,253	V372F	probably benign	Het
Adcy10	G	A	1: 165,519,895	C393Y	probably damaging	Het
Adgrg7	A	C	16: 56,730,306	I681S	possibly damaging	Het
Akap8l	T	C	17: 32,321,511		probably benign	Het
Akr1a1	A	T	4: 116,639,895	V156E	probably damaging	Het
Alk	T	G	17: 71,895,739	D1167A	probably damaging	Het
Ankrd11	T	C	8: 122,893,714		probably null	Het
Aspm	T	A	1: 139,457,483	N288K	probably damaging	Het
Aspm	A	G	1: 139,470,395		probably null	Het
Asxl2	G	A	12: 3,474,618		probably null	Het
Atp6v0a1	A	G	11: 101,055,587	H802R	probably damaging	Het
B4galnt1	A	G	10: 127,171,822	T531A	possibly damaging	Het
Ccdc114	C	T	7: 45,942,082	R257*	probably null	Het
Cecr2	A	G	6: 120,756,569	N506D	possibly damaging	Het
Crebrf	T	C	17: 26,759,865	V509A	probably damaging	Het
Cyp4f40	A	T	17: 32,675,616	I413F	probably null	Het
Defb12	C	A	8: 19,114,326		probably null	Het
Dnah2	T	C	11: 69,421,848	E4297G	probably damaging	Het
Dpysl5	A	T	5: 30,791,513	N371Y	probably damaging	Het
Eef1d	G	T	15: 75,903,189	T207N	probably benign	Het
Esrrb	C	T	12: 86,519,009	Q416*	probably null	Het
Exd2	T	C	12: 80,489,448	L284P	probably damaging	Het
Fat3	T	A	9: 16,376,443	I595F	probably benign	Het
Gm9920	A	G	15: 55,108,975		probably benign	Het
Hephl1	T	C	9: 15,069,788	K783E	probably damaging	Het
Irs2	A	G	8: 11,005,277	S1052P	probably benign	Het
Kctd18	T	C	1: 57,963,093	I192V	probably benign	Het
Lama3	A	G	18: 12,453,746	D722G	probably damaging	Het
Lepr	T	C	4: 101,815,019	V1080A	possibly damaging	Het
Lpin1	C	T	12: 16,563,655	G504S	probably damaging	Het
Lrit2	A	C	14: 37,069,183	Q273P	possibly damaging	Het
Mgea5	A	T	19: 45,758,022	Y779*	probably null	Het
Mlkl	T	A	8: 111,327,937	E189D	probably benign	Het
Nav2	T	C	7: 49,589,160	V2011A	probably benign	Het
Nos2	A	T	11: 78,957,491	I1075F	probably benign	Het
Npat	A	G	9: 53,550,036		probably null	Het
Nucks1	T	C	1: 131,919,033	F16L	probably damaging	Het
Nus1	T	C	10: 52,429,213	S150P	possibly damaging	Het
Olfr1230	G	T	2: 89,297,162	T36K	probably damaging	Het
Olfr881	A	T	9: 37,992,612	Y40F	probably benign	Het
Pclo	A	G	5: 14,681,353	T3290A	unknown	Het
Pign	A	T	1: 105,657,812	F4Y	probably benign	Het
Rfx4	A	G	10: 84,860,542	N233D	possibly damaging	Het
Rpgrip1	A	T	14: 52,160,195	M1325L	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Scaf11	T	A	15: 96,417,120	H1227L	possibly damaging	Het
Sec31b	G	T	19: 44,518,637	P840T	probably damaging	Het
Slc16a9	T	A	10: 70,283,128	L426I	probably damaging	Het
Slc17a2	T	C	13: 23,812,592	S27P	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Tacc1	A	G	8: 25,182,283	S310P	possibly damaging	Het
Tmem245	G	A	4: 56,947,084	R110C	probably damaging	Het
Trip12	T	C	1: 84,757,431	Y953C	probably damaging	Het
Trpm7	C	A	2: 126,842,855		probably null	Het
Ush2a	G	A	1: 188,912,123	V4561I	probably benign	Het
Vmn1r192	C	T	13: 22,187,631	V140I	probably benign	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	T	C	17: 19,379,269	V405A	probably damaging	Het
Wdhd1	A	C	14: 47,272,221	V172G	probably benign	Het
Zfhx3	C	T	8: 108,951,185	R2956C	possibly damaging	Het
Zfp446	T	C	7: 12,982,251	L283P	possibly damaging	Het
Zfp82	T	C	7: 30,057,166	K164E	probably damaging	Het

Other mutations in Mttp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00722:Mttp	APN	3	138109015	missense	possibly damaging	0.84
IGL00983:Mttp	APN	3	138115129	splice site	probably benign
IGL01128:Mttp	APN	3	138133997	splice site	probably null
IGL01607:Mttp	APN	3	138104698	missense	probably damaging	0.99
IGL01760:Mttp	APN	3	138111736	missense	probably benign	0.00
IGL01947:Mttp	APN	3	138107129	missense	probably damaging	1.00
IGL02184:Mttp	APN	3	138116000	critical splice donor site	probably null
IGL02932:Mttp	APN	3	138111744	missense	probably benign	0.07
IGL02957:Mttp	APN	3	138109081	missense	possibly damaging	0.95
IGL03082:Mttp	APN	3	138123795	missense	probably benign	0.01
IGL03302:Mttp	APN	3	138104707	missense	possibly damaging	0.90
IGL03381:Mttp	APN	3	138104943	missense	probably damaging	1.00
G1patch:Mttp	UTSW	3	138107238	missense	probably damaging	1.00
P0040:Mttp	UTSW	3	138112566	missense	possibly damaging	0.82
R0543:Mttp	UTSW	3	138111696	missense	possibly damaging	0.75
R0738:Mttp	UTSW	3	138103313	missense	probably damaging	1.00
R0967:Mttp	UTSW	3	138092723	missense	probably benign	0.00
R1281:Mttp	UTSW	3	138107219	missense	possibly damaging	0.95
R1565:Mttp	UTSW	3	138116405	critical splice donor site	probably null
R1660:Mttp	UTSW	3	138103193	missense	probably damaging	1.00
R1828:Mttp	UTSW	3	138107280	missense	probably damaging	1.00
R1886:Mttp	UTSW	3	138092615	missense	probably damaging	1.00
R1912:Mttp	UTSW	3	138116027	missense	probably benign	0.01
R1938:Mttp	UTSW	3	138125121	missense	probably benign	0.21
R2020:Mttp	UTSW	3	138118402	missense	probably damaging	0.98
R2109:Mttp	UTSW	3	138095002	missense	probably benign	0.27
R2336:Mttp	UTSW	3	138116095	missense	possibly damaging	0.81
R2392:Mttp	UTSW	3	138095021	missense	probably damaging	0.98
R3021:Mttp	UTSW	3	138111703	missense	probably benign
R3774:Mttp	UTSW	3	138114263	splice site	probably null
R3776:Mttp	UTSW	3	138114263	splice site	probably null
R4687:Mttp	UTSW	3	138092735	missense	possibly damaging	0.66
R4708:Mttp	UTSW	3	138134098	unclassified	probably benign
R4756:Mttp	UTSW	3	138116071	missense	possibly damaging	0.77
R4832:Mttp	UTSW	3	138116050	missense	probably benign
R5670:Mttp	UTSW	3	138125113	missense	probably damaging	0.99
R6613:Mttp	UTSW	3	138109078	missense	probably damaging	1.00
R6725:Mttp	UTSW	3	138107238	missense	probably damaging	1.00
R6799:Mttp	UTSW	3	138095080	missense	probably benign	0.04
R6920:Mttp	UTSW	3	138115282	missense	possibly damaging	0.49
R7074:Mttp	UTSW	3	138107273	missense	possibly damaging	0.53
R7131:Mttp	UTSW	3	138116132	missense	probably benign	0.13
R7275:Mttp	UTSW	3	138123785	missense	probably benign	0.19
R7291:Mttp	UTSW	3	138091203	missense	probably damaging	1.00
R7310:Mttp	UTSW	3	138095022	missense	probably damaging	1.00
R7769:Mttp	UTSW	3	138103112	missense	probably damaging	1.00
R7909:Mttp	UTSW	3	138118417	nonsense	probably null
R8037:Mttp	UTSW	3	138091122	missense	probably damaging	1.00
R8220:Mttp	UTSW	3	138123848	missense	probably benign	0.00
R8335:Mttp	UTSW	3	138103212	missense	possibly damaging	0.90
R8352:Mttp	UTSW	3	138112613	missense	probably damaging	1.00
R8452:Mttp	UTSW	3	138112613	missense	probably damaging	1.00
R8536:Mttp	UTSW	3	138104943	missense	probably damaging	1.00
R8677:Mttp	UTSW	3	138104676	missense	probably benign	0.00
R8877:Mttp	UTSW	3	138112556	missense	probably damaging	0.99
R9233:Mttp	UTSW	3	138116519	missense	probably damaging	1.00
R9237:Mttp	UTSW	3	138104683	missense	probably benign
R9427:Mttp	UTSW	3	138115201	missense	probably benign	0.01
Z1176:Mttp	UTSW	3	138104779	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAAGGCTGTATGTGGACGC -3'
(R):5'- TCAGCTGAAGTCGTCCCTTG -3'

Sequencing Primer
(F):5'- CTGTATGTGGACGCTGCAC -3'
(R):5'- TCCCGATTTGATCTGGGA -3'

Posted On

2016-08-04