Incidental Mutation 'R5377:Akr1a1'
ID425604
Institutional Source Beutler Lab
Gene Symbol Akr1a1
Ensembl Gene ENSMUSG00000028692
Gene Namealdo-keto reductase family 1, member A1 (aldehyde reductase)
SynonymsAkr1a4, 2610201A18Rik
MMRRC Submission 042845-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R5377 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116636510-116651680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116639895 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 156 (V156E)
Ref Sequence ENSEMBL: ENSMUSP00000114861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030455] [ENSMUST00000128059]
Predicted Effect probably damaging
Transcript: ENSMUST00000030455
AA Change: V156E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030455
Gene: ENSMUSG00000028692
AA Change: V156E

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 16 294 1.4e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128010
Predicted Effect probably damaging
Transcript: ENSMUST00000128059
AA Change: V156E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114861
Gene: ENSMUSG00000028692
AA Change: V156E

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 16 204 3.7e-43 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member, also known as aldehyde reductase, is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue. Multiple alternatively spliced transcript variants of this gene exist, all encoding the same protein. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased osteoporosis in response to pregnancy or castration in the absence of dietary ascorbate. Mice homozygous for a knock-out allele exhibit reduced asorbic acid levels and DL-glyceraldehyde, glucuronolactone and glucuronate reductase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,645,253 V372F probably benign Het
Adcy10 G A 1: 165,519,895 C393Y probably damaging Het
Adgrg7 A C 16: 56,730,306 I681S possibly damaging Het
Akap8l T C 17: 32,321,511 probably benign Het
Alk T G 17: 71,895,739 D1167A probably damaging Het
Ankrd11 T C 8: 122,893,714 probably null Het
Aspm T A 1: 139,457,483 N288K probably damaging Het
Aspm A G 1: 139,470,395 probably null Het
Asxl2 G A 12: 3,474,618 probably null Het
Atp6v0a1 A G 11: 101,055,587 H802R probably damaging Het
B4galnt1 A G 10: 127,171,822 T531A possibly damaging Het
Ccdc114 C T 7: 45,942,082 R257* probably null Het
Cecr2 A G 6: 120,756,569 N506D possibly damaging Het
Crebrf T C 17: 26,759,865 V509A probably damaging Het
Cyp4f40 A T 17: 32,675,616 I413F probably null Het
Defb12 C A 8: 19,114,326 probably null Het
Dnah2 T C 11: 69,421,848 E4297G probably damaging Het
Dpysl5 A T 5: 30,791,513 N371Y probably damaging Het
Eef1d G T 15: 75,903,189 T207N probably benign Het
Esrrb C T 12: 86,519,009 Q416* probably null Het
Exd2 T C 12: 80,489,448 L284P probably damaging Het
Fat3 T A 9: 16,376,443 I595F probably benign Het
Gm9920 A G 15: 55,108,975 probably benign Het
Hephl1 T C 9: 15,069,788 K783E probably damaging Het
Irs2 A G 8: 11,005,277 S1052P probably benign Het
Kctd18 T C 1: 57,963,093 I192V probably benign Het
Lama3 A G 18: 12,453,746 D722G probably damaging Het
Lepr T C 4: 101,815,019 V1080A possibly damaging Het
Lpin1 C T 12: 16,563,655 G504S probably damaging Het
Lrit2 A C 14: 37,069,183 Q273P possibly damaging Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Mlkl T A 8: 111,327,937 E189D probably benign Het
Mttp C T 3: 138,105,029 R608H probably benign Het
Nav2 T C 7: 49,589,160 V2011A probably benign Het
Nos2 A T 11: 78,957,491 I1075F probably benign Het
Npat A G 9: 53,550,036 probably null Het
Nucks1 T C 1: 131,919,033 F16L probably damaging Het
Nus1 T C 10: 52,429,213 S150P possibly damaging Het
Olfr1230 G T 2: 89,297,162 T36K probably damaging Het
Olfr881 A T 9: 37,992,612 Y40F probably benign Het
Pclo A G 5: 14,681,353 T3290A unknown Het
Pign A T 1: 105,657,812 F4Y probably benign Het
Rfx4 A G 10: 84,860,542 N233D possibly damaging Het
Rpgrip1 A T 14: 52,160,195 M1325L possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf11 T A 15: 96,417,120 H1227L possibly damaging Het
Sec31b G T 19: 44,518,637 P840T probably damaging Het
Slc16a9 T A 10: 70,283,128 L426I probably damaging Het
Slc17a2 T C 13: 23,812,592 S27P probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Tacc1 A G 8: 25,182,283 S310P possibly damaging Het
Tmem245 G A 4: 56,947,084 R110C probably damaging Het
Trip12 T C 1: 84,757,431 Y953C probably damaging Het
Trpm7 C A 2: 126,842,855 probably null Het
Ush2a G A 1: 188,912,123 V4561I probably benign Het
Vmn1r192 C T 13: 22,187,631 V140I probably benign Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 T C 17: 19,379,269 V405A probably damaging Het
Wdhd1 A C 14: 47,272,221 V172G probably benign Het
Zfhx3 C T 8: 108,951,185 R2956C possibly damaging Het
Zfp446 T C 7: 12,982,251 L283P possibly damaging Het
Zfp82 T C 7: 30,057,166 K164E probably damaging Het
Other mutations in Akr1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02927:Akr1a1 APN 4 116637983 missense probably damaging 1.00
IGL03176:Akr1a1 APN 4 116639075 missense probably damaging 1.00
IGL03265:Akr1a1 APN 4 116637817 missense probably benign 0.42
R0480:Akr1a1 UTSW 4 116639847 missense possibly damaging 0.84
R0972:Akr1a1 UTSW 4 116640007 critical splice acceptor site probably null
R1649:Akr1a1 UTSW 4 116638020 missense probably damaging 1.00
R1711:Akr1a1 UTSW 4 116637974 critical splice donor site probably null
R1727:Akr1a1 UTSW 4 116641051 missense probably damaging 1.00
R1822:Akr1a1 UTSW 4 116636653 missense probably benign 0.13
R4653:Akr1a1 UTSW 4 116637959 unclassified probably benign
R7386:Akr1a1 UTSW 4 116641054 missense probably damaging 0.98
R7458:Akr1a1 UTSW 4 116637817 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CAACTTGCCACCTCCATTAAGG -3'
(R):5'- AGCATTGCAGTTCCTAATTCTTGTC -3'

Sequencing Primer
(F):5'- CCATTAAGGAGATTCCCCACTTG -3'
(R):5'- CTTATGGTGTGGTCCACAGAATAGC -3'
Posted On2016-08-04