Mutagenetix > Incidental Mutations

Incidental Mutation 'R5377:Irs2'

425615

Institutional Source

Beutler Lab

Gene Symbol

Irs2

Ensembl Gene

ENSMUSG00000038894

Gene Name

insulin receptor substrate 2

Synonyms

Irs-2

MMRRC Submission

042845-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.461) question?

Stock #

R5377 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10984681-11008458 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11005277 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1052 (S1052P)

Ref Sequence

ENSEMBL: ENSMUSP00000038514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040514]

PDB Structure

Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000040514
AA Change: S1052P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: S1052P

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
low complexity region	19	28	N/A	INTRINSIC
PH	31	146	2.83e-13	SMART
IRS	191	293	4.98e-38	SMART
PTBI	191	293	2.24e-51	SMART
low complexity region	301	309	N/A	INTRINSIC
low complexity region	364	377	N/A	INTRINSIC
low complexity region	435	473	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	688	710	N/A	INTRINSIC
low complexity region	721	730	N/A	INTRINSIC
low complexity region	834	846	N/A	INTRINSIC
low complexity region	923	959	N/A	INTRINSIC
low complexity region	976	984	N/A	INTRINSIC
low complexity region	997	1028	N/A	INTRINSIC
low complexity region	1137	1154	N/A	INTRINSIC
low complexity region	1191	1208	N/A	INTRINSIC
low complexity region	1274	1296	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180750

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,645,253	V372F	probably benign	Het
Adcy10	G	A	1: 165,519,895	C393Y	probably damaging	Het
Adgrg7	A	C	16: 56,730,306	I681S	possibly damaging	Het
Akap8l	T	C	17: 32,321,511		probably benign	Het
Akr1a1	A	T	4: 116,639,895	V156E	probably damaging	Het
Alk	T	G	17: 71,895,739	D1167A	probably damaging	Het
Ankrd11	T	C	8: 122,893,714		probably null	Het
Aspm	T	A	1: 139,457,483	N288K	probably damaging	Het
Aspm	A	G	1: 139,470,395		probably null	Het
Asxl2	G	A	12: 3,474,618		probably null	Het
Atp6v0a1	A	G	11: 101,055,587	H802R	probably damaging	Het
B4galnt1	A	G	10: 127,171,822	T531A	possibly damaging	Het
Ccdc114	C	T	7: 45,942,082	R257*	probably null	Het
Cecr2	A	G	6: 120,756,569	N506D	possibly damaging	Het
Crebrf	T	C	17: 26,759,865	V509A	probably damaging	Het
Cyp4f40	A	T	17: 32,675,616	I413F	probably null	Het
Defb12	C	A	8: 19,114,326		probably null	Het
Dnah2	T	C	11: 69,421,848	E4297G	probably damaging	Het
Dpysl5	A	T	5: 30,791,513	N371Y	probably damaging	Het
Eef1d	G	T	15: 75,903,189	T207N	probably benign	Het
Esrrb	C	T	12: 86,519,009	Q416*	probably null	Het
Exd2	T	C	12: 80,489,448	L284P	probably damaging	Het
Fat3	T	A	9: 16,376,443	I595F	probably benign	Het
Gm9920	A	G	15: 55,108,975		probably benign	Het
Hephl1	T	C	9: 15,069,788	K783E	probably damaging	Het
Kctd18	T	C	1: 57,963,093	I192V	probably benign	Het
Lama3	A	G	18: 12,453,746	D722G	probably damaging	Het
Lepr	T	C	4: 101,815,019	V1080A	possibly damaging	Het
Lpin1	C	T	12: 16,563,655	G504S	probably damaging	Het
Lrit2	A	C	14: 37,069,183	Q273P	possibly damaging	Het
Mgea5	A	T	19: 45,758,022	Y779*	probably null	Het
Mlkl	T	A	8: 111,327,937	E189D	probably benign	Het
Mttp	C	T	3: 138,105,029	R608H	probably benign	Het
Nav2	T	C	7: 49,589,160	V2011A	probably benign	Het
Nos2	A	T	11: 78,957,491	I1075F	probably benign	Het
Npat	A	G	9: 53,550,036		probably null	Het
Nucks1	T	C	1: 131,919,033	F16L	probably damaging	Het
Nus1	T	C	10: 52,429,213	S150P	possibly damaging	Het
Olfr1230	G	T	2: 89,297,162	T36K	probably damaging	Het
Olfr881	A	T	9: 37,992,612	Y40F	probably benign	Het
Pclo	A	G	5: 14,681,353	T3290A	unknown	Het
Pign	A	T	1: 105,657,812	F4Y	probably benign	Het
Rfx4	A	G	10: 84,860,542	N233D	possibly damaging	Het
Rpgrip1	A	T	14: 52,160,195	M1325L	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Scaf11	T	A	15: 96,417,120	H1227L	possibly damaging	Het
Sec31b	G	T	19: 44,518,637	P840T	probably damaging	Het
Slc16a9	T	A	10: 70,283,128	L426I	probably damaging	Het
Slc17a2	T	C	13: 23,812,592	S27P	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Tacc1	A	G	8: 25,182,283	S310P	possibly damaging	Het
Tmem245	G	A	4: 56,947,084	R110C	probably damaging	Het
Trip12	T	C	1: 84,757,431	Y953C	probably damaging	Het
Trpm7	C	A	2: 126,842,855		probably null	Het
Ush2a	G	A	1: 188,912,123	V4561I	probably benign	Het
Vmn1r192	C	T	13: 22,187,631	V140I	probably benign	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	T	C	17: 19,379,269	V405A	probably damaging	Het
Wdhd1	A	C	14: 47,272,221	V172G	probably benign	Het
Zfhx3	C	T	8: 108,951,185	R2956C	possibly damaging	Het
Zfp446	T	C	7: 12,982,251	L283P	possibly damaging	Het
Zfp82	T	C	7: 30,057,166	K164E	probably damaging	Het

Other mutations in Irs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Irs2	APN	8	11005867	missense	probably benign	0.00
IGL01328:Irs2	APN	8	11004792	missense	probably damaging	0.99
IGL01875:Irs2	APN	8	11006221	missense	probably damaging	0.98
IGL02444:Irs2	APN	8	11006306	missense	probably benign	0.03
IGL02448:Irs2	APN	8	11007862	missense	probably benign	0.21
IGL02945:Irs2	APN	8	11007781	missense	probably damaging	1.00
IGL03068:Irs2	APN	8	11004974	missense	probably damaging	0.99
beefed	UTSW	8	11006522	nonsense	probably null
Dum_dum	UTSW	8	10987012	makesense	probably null
Lush	UTSW	8	11006678	nonsense	probably null
muscular	UTSW	8	11004659	nonsense	probably null
R0062:Irs2	UTSW	8	11005723	missense	possibly damaging	0.65
R0062:Irs2	UTSW	8	11005723	missense	possibly damaging	0.65
R0107:Irs2	UTSW	8	11004691	missense	probably damaging	1.00
R0147:Irs2	UTSW	8	11007568	missense	probably damaging	1.00
R0501:Irs2	UTSW	8	11006396	missense	probably damaging	1.00
R0565:Irs2	UTSW	8	11004592	missense	probably damaging	0.98
R2042:Irs2	UTSW	8	11007580	missense	probably damaging	0.99
R2268:Irs2	UTSW	8	11007586	missense	probably damaging	0.98
R2518:Irs2	UTSW	8	11005352	missense	probably benign	0.00
R2762:Irs2	UTSW	8	11006408	missense	probably damaging	1.00
R3623:Irs2	UTSW	8	11007643	missense	probably damaging	1.00
R3624:Irs2	UTSW	8	11007643	missense	probably damaging	1.00
R5022:Irs2	UTSW	8	10987012	makesense	probably null
R5270:Irs2	UTSW	8	11006678	nonsense	probably null
R5604:Irs2	UTSW	8	11005007	missense	possibly damaging	0.84
R6049:Irs2	UTSW	8	11006805	missense	probably benign	0.01
R6219:Irs2	UTSW	8	11005121	missense	probably damaging	0.99
R6654:Irs2	UTSW	8	11006486	missense	probably damaging	1.00
R6726:Irs2	UTSW	8	11004961	missense	possibly damaging	0.86
R6813:Irs2	UTSW	8	11004659	nonsense	probably null
R6934:Irs2	UTSW	8	11004697	missense	probably damaging	0.99
R7261:Irs2	UTSW	8	11007018	missense	possibly damaging	0.95
R7285:Irs2	UTSW	8	11006797	missense	probably damaging	0.99
R7458:Irs2	UTSW	8	11007739	missense	probably damaging	0.99
R7757:Irs2	UTSW	8	11006522	nonsense	probably null
R8347:Irs2	UTSW	8	11008000	missense	possibly damaging	0.82
R8377:Irs2	UTSW	8	11004848	nonsense	probably null
R8444:Irs2	UTSW	8	11006683	missense	probably damaging	0.99
Z1176:Irs2	UTSW	8	11006185	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGACTTGAAGGAAAGCCTCC -3'
(R):5'- GGACTTCAGTTCTCCCAAGTC -3'

Sequencing Primer
(F):5'- CACCCCAGATACCTGATCCATGAG -3'
(R):5'- CACAGTAGGCTCCATGGATG -3'

Posted On

2016-08-04