Mutagenetix > Incidental Mutations

Incidental Mutation 'R5377:Rfx4'

425628

Institutional Source

Beutler Lab

Gene Symbol

Rfx4

Ensembl Gene

ENSMUSG00000020037

Gene Name

regulatory factor X, 4 (influences HLA class II expression)

Synonyms

4933412G19Rik

MMRRC Submission

042845-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5377 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84756062-84906538 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 84860542 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 233 (N233D)

Ref Sequence

ENSEMBL: ENSMUSP00000093035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060397] [ENSMUST00000095388] [ENSMUST00000166696]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000020226

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060397
AA Change: N327D

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000051107
Gene: ENSMUSG00000020037
AA Change: N327D

Domain	Start	End	E-Value	Type
Pfam:RFX_DNA_binding	58	136	7.9e-37	PFAM
Blast:HisKA	293	356	5e-7	BLAST
low complexity region	503	515	N/A	INTRINSIC
low complexity region	521	537	N/A	INTRINSIC
low complexity region	599	611	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095388
AA Change: N233D

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000093035
Gene: ENSMUSG00000020037
AA Change: N233D

Domain	Start	End	E-Value	Type
SCOP:d1kwha_	11	201	6e-3	SMART
Blast:HisKA	199	262	4e-7	BLAST
low complexity region	409	421	N/A	INTRINSIC
low complexity region	427	443	N/A	INTRINSIC
low complexity region	505	517	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166696
AA Change: N184D

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000128690
Gene: ENSMUSG00000020037
AA Change: N184D

Domain	Start	End	E-Value	Type
Blast:HisKA	150	213	6e-7	BLAST
low complexity region	360	372	N/A	INTRINSIC
low complexity region	378	394	N/A	INTRINSIC
low complexity region	456	468	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X3, and X5. It has been shown to interact with itself as well as with regulatory factors X2 and X3, but it does not interact with regulatory factor X1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Inactivating null allele or homozygous point mutation alleles exhibit missing dorsal midline structure of the cortex including the subcommissural organ and neonatal lethality. Heterozygous null mice have congenital hydrocephalus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,645,253	V372F	probably benign	Het
Adcy10	G	A	1: 165,519,895	C393Y	probably damaging	Het
Adgrg7	A	C	16: 56,730,306	I681S	possibly damaging	Het
Akap8l	T	C	17: 32,321,511		probably benign	Het
Akr1a1	A	T	4: 116,639,895	V156E	probably damaging	Het
Alk	T	G	17: 71,895,739	D1167A	probably damaging	Het
Ankrd11	T	C	8: 122,893,714		probably null	Het
Aspm	T	A	1: 139,457,483	N288K	probably damaging	Het
Aspm	A	G	1: 139,470,395		probably null	Het
Asxl2	G	A	12: 3,474,618		probably null	Het
Atp6v0a1	A	G	11: 101,055,587	H802R	probably damaging	Het
B4galnt1	A	G	10: 127,171,822	T531A	possibly damaging	Het
Ccdc114	C	T	7: 45,942,082	R257*	probably null	Het
Cecr2	A	G	6: 120,756,569	N506D	possibly damaging	Het
Crebrf	T	C	17: 26,759,865	V509A	probably damaging	Het
Cyp4f40	A	T	17: 32,675,616	I413F	probably null	Het
Defb12	C	A	8: 19,114,326		probably null	Het
Dnah2	T	C	11: 69,421,848	E4297G	probably damaging	Het
Dpysl5	A	T	5: 30,791,513	N371Y	probably damaging	Het
Eef1d	G	T	15: 75,903,189	T207N	probably benign	Het
Esrrb	C	T	12: 86,519,009	Q416*	probably null	Het
Exd2	T	C	12: 80,489,448	L284P	probably damaging	Het
Fat3	T	A	9: 16,376,443	I595F	probably benign	Het
Gm9920	A	G	15: 55,108,975		probably benign	Het
Hephl1	T	C	9: 15,069,788	K783E	probably damaging	Het
Irs2	A	G	8: 11,005,277	S1052P	probably benign	Het
Kctd18	T	C	1: 57,963,093	I192V	probably benign	Het
Lama3	A	G	18: 12,453,746	D722G	probably damaging	Het
Lepr	T	C	4: 101,815,019	V1080A	possibly damaging	Het
Lpin1	C	T	12: 16,563,655	G504S	probably damaging	Het
Lrit2	A	C	14: 37,069,183	Q273P	possibly damaging	Het
Mgea5	A	T	19: 45,758,022	Y779*	probably null	Het
Mlkl	T	A	8: 111,327,937	E189D	probably benign	Het
Mttp	C	T	3: 138,105,029	R608H	probably benign	Het
Nav2	T	C	7: 49,589,160	V2011A	probably benign	Het
Nos2	A	T	11: 78,957,491	I1075F	probably benign	Het
Npat	A	G	9: 53,550,036		probably null	Het
Nucks1	T	C	1: 131,919,033	F16L	probably damaging	Het
Nus1	T	C	10: 52,429,213	S150P	possibly damaging	Het
Olfr1230	G	T	2: 89,297,162	T36K	probably damaging	Het
Olfr881	A	T	9: 37,992,612	Y40F	probably benign	Het
Pclo	A	G	5: 14,681,353	T3290A	unknown	Het
Pign	A	T	1: 105,657,812	F4Y	probably benign	Het
Rpgrip1	A	T	14: 52,160,195	M1325L	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Scaf11	T	A	15: 96,417,120	H1227L	possibly damaging	Het
Sec31b	G	T	19: 44,518,637	P840T	probably damaging	Het
Slc16a9	T	A	10: 70,283,128	L426I	probably damaging	Het
Slc17a2	T	C	13: 23,812,592	S27P	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Tacc1	A	G	8: 25,182,283	S310P	possibly damaging	Het
Tmem245	G	A	4: 56,947,084	R110C	probably damaging	Het
Trip12	T	C	1: 84,757,431	Y953C	probably damaging	Het
Trpm7	C	A	2: 126,842,855		probably null	Het
Ush2a	G	A	1: 188,912,123	V4561I	probably benign	Het
Vmn1r192	C	T	13: 22,187,631	V140I	probably benign	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	T	C	17: 19,379,269	V405A	probably damaging	Het
Wdhd1	A	C	14: 47,272,221	V172G	probably benign	Het
Zfhx3	C	T	8: 108,951,185	R2956C	possibly damaging	Het
Zfp446	T	C	7: 12,982,251	L283P	possibly damaging	Het
Zfp82	T	C	7: 30,057,166	K164E	probably damaging	Het

Other mutations in Rfx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Rfx4	APN	10	84840199	missense	probably damaging	1.00
IGL00334:Rfx4	APN	10	84780053	missense	possibly damaging	0.91
IGL00928:Rfx4	APN	10	84840114	missense	probably benign	0.04
IGL01063:Rfx4	APN	10	84868382	missense	possibly damaging	0.90
IGL01490:Rfx4	APN	10	84840851	missense	possibly damaging	0.85
IGL02390:Rfx4	APN	10	84840150	missense	probably damaging	1.00
IGL02454:Rfx4	APN	10	84840106	missense	possibly damaging	0.83
R0099:Rfx4	UTSW	10	84894304	missense	probably benign
R0503:Rfx4	UTSW	10	84894332	missense	possibly damaging	0.56
R0924:Rfx4	UTSW	10	84868427	missense	probably damaging	1.00
R0930:Rfx4	UTSW	10	84868427	missense	probably damaging	1.00
R1386:Rfx4	UTSW	10	84863285	missense	probably damaging	1.00
R1715:Rfx4	UTSW	10	84844280	missense	probably damaging	1.00
R1738:Rfx4	UTSW	10	84880975	critical splice donor site	probably null
R1987:Rfx4	UTSW	10	84896088	missense	possibly damaging	0.87
R3717:Rfx4	UTSW	10	84880224	missense	probably damaging	1.00
R4231:Rfx4	UTSW	10	84814694	missense	probably benign	0.03
R4300:Rfx4	UTSW	10	84905102	missense	probably damaging	0.98
R4581:Rfx4	UTSW	10	84844300	missense	possibly damaging	0.93
R4582:Rfx4	UTSW	10	84844300	missense	possibly damaging	0.93
R4618:Rfx4	UTSW	10	84880896	missense	probably benign	0.01
R5156:Rfx4	UTSW	10	84868354	missense	probably damaging	1.00
R5185:Rfx4	UTSW	10	84863250	missense	probably damaging	1.00
R5601:Rfx4	UTSW	10	84798578	missense	probably damaging	1.00
R5879:Rfx4	UTSW	10	84814761	critical splice donor site	probably null
R5996:Rfx4	UTSW	10	84840017	nonsense	probably null
R6358:Rfx4	UTSW	10	84844235	missense	probably damaging	1.00
R6805:Rfx4	UTSW	10	84840228	missense	possibly damaging	0.86
R7248:Rfx4	UTSW	10	84905055	missense	probably benign	0.05
R7427:Rfx4	UTSW	10	84896012	missense	probably benign	0.28
R7428:Rfx4	UTSW	10	84896012	missense	probably benign	0.28
R7514:Rfx4	UTSW	10	84880226	missense	probably damaging	1.00
R7576:Rfx4	UTSW	10	84863349	missense	probably damaging	0.98
R8002:Rfx4	UTSW	10	84840857	missense	probably damaging	0.97
RF010:Rfx4	UTSW	10	84858487	critical splice acceptor site	probably benign
RF014:Rfx4	UTSW	10	84858489	critical splice acceptor site	probably benign
RF015:Rfx4	UTSW	10	84858489	critical splice acceptor site	probably benign
RF023:Rfx4	UTSW	10	84858485	critical splice acceptor site	probably benign
RF030:Rfx4	UTSW	10	84858480	critical splice acceptor site	probably benign
RF035:Rfx4	UTSW	10	84858480	critical splice acceptor site	probably benign
RF046:Rfx4	UTSW	10	84858481	critical splice acceptor site	probably benign
RF060:Rfx4	UTSW	10	84858494	critical splice acceptor site	probably benign
RF062:Rfx4	UTSW	10	84858481	critical splice acceptor site	probably benign
X0024:Rfx4	UTSW	10	84780074	missense	possibly damaging	0.82
Z1177:Rfx4	UTSW	10	84814684	missense	possibly damaging	0.85
Z1177:Rfx4	UTSW	10	84896091	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- GCAGGAGTTAGCCAGTAAGTC -3'
(R):5'- TTTGAGGCCCCAGATCATGTC -3'

Sequencing Primer
(F):5'- GTTAGCCAGTAAGTCCCTAAAACAG -3'
(R):5'- TCATGTCTGAAAGGTACAGGGGC -3'

Posted On

2016-08-04