Incidental Mutation 'R0492:Sorl1'
ID42563
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Namesortilin-related receptor, LDLR class A repeats-containing
Synonyms2900010L19Rik, mSorLA, Sorla, LR11
MMRRC Submission 038690-MU
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R0492 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location41964720-42124297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41991371 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1630 (H1630R)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
Predicted Effect probably null
Transcript: ENSMUST00000060989
AA Change: H1630R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: H1630R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A T 5: 24,554,628 L48Q probably damaging Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Adgre1 A G 17: 57,402,742 D133G unknown Het
AI314180 A G 4: 58,864,418 W288R probably damaging Het
Alpl A C 4: 137,749,576 probably null Het
Ankrd65 T C 4: 155,790,676 probably benign Het
Baalc A T 15: 38,934,085 probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Bud31 A G 5: 145,146,455 Y77C probably damaging Het
Capsl A G 15: 9,461,844 probably benign Het
Ccna1 A G 3: 55,048,583 V116A probably damaging Het
Cdc42bpa C A 1: 180,101,190 H723N probably benign Het
Cfap161 T C 7: 83,794,037 I40V possibly damaging Het
CK137956 C T 4: 127,951,300 V217I probably benign Het
Cog5 A G 12: 31,869,461 T540A probably damaging Het
Cps1 T C 1: 67,157,836 W349R probably damaging Het
Crispld2 G T 8: 120,026,067 V285L probably benign Het
Crtc2 T A 3: 90,263,497 F626I probably damaging Het
Daam1 G A 12: 71,944,380 R256H unknown Het
Dhx38 G T 8: 109,561,944 probably benign Het
Dok4 G A 8: 94,865,136 A324V probably benign Het
Dscam T C 16: 96,825,782 probably null Het
Dusp16 A T 6: 134,718,402 S489T probably benign Het
Erbin A T 13: 103,834,358 Y917N probably damaging Het
F13b A T 1: 139,522,559 probably null Het
Fam26f G A 10: 34,127,651 R87* probably null Het
Fdx1 C A 9: 51,963,425 A15S probably benign Het
Ffar4 A T 19: 38,097,182 Q19L probably benign Het
Folh1 A C 7: 86,746,192 V344G probably damaging Het
Fscb T A 12: 64,473,518 E391D possibly damaging Het
Gigyf2 G A 1: 87,440,846 G1083R probably damaging Het
Gm14403 C A 2: 177,508,566 H102N probably benign Het
Gm4847 A G 1: 166,630,392 F464S probably damaging Het
Gpam A T 19: 55,096,179 M56K possibly damaging Het
Gpr165 T A X: 96,717,172 F352I probably damaging Het
Grik2 T G 10: 49,101,164 I891L probably damaging Het
Gsr T C 8: 33,681,575 probably benign Het
Hhla1 A G 15: 65,936,291 F302L probably benign Het
Impg1 T C 9: 80,345,308 D453G possibly damaging Het
Inpp5d T A 1: 87,698,150 V495E possibly damaging Het
Iqce A T 5: 140,675,235 L450H probably damaging Het
Itfg2 A G 6: 128,413,523 probably null Het
Kif13a A G 13: 46,812,742 V400A possibly damaging Het
Kif7 T C 7: 79,713,881 Y93C probably damaging Het
Krt33a A G 11: 100,016,083 V22A probably benign Het
Lct T C 1: 128,300,582 D1058G probably damaging Het
Lrp6 G T 6: 134,480,518 D774E possibly damaging Het
Lrrc9 T A 12: 72,478,763 S828R possibly damaging Het
Ly75 A G 2: 60,308,276 W1416R probably damaging Het
Mdh2 T C 5: 135,790,150 I320T possibly damaging Het
Med13l T A 5: 118,738,495 V912E probably damaging Het
Mgarp T C 3: 51,389,035 D182G possibly damaging Het
Mllt10 T C 2: 18,146,887 probably benign Het
Mmp28 G A 11: 83,443,803 A375V probably damaging Het
Mrps23 T A 11: 88,210,685 H133Q probably benign Het
Msh6 T C 17: 87,975,251 S35P probably benign Het
Myo3a A G 2: 22,323,636 D347G possibly damaging Het
Npc1l1 T C 11: 6,223,040 K800E possibly damaging Het
Olfr1034 T C 2: 86,046,587 V35A probably benign Het
Olfr1034 T C 2: 86,046,934 F151L possibly damaging Het
Olfr1086 G A 2: 86,676,490 P281L probably damaging Het
Olfr152 T G 2: 87,782,822 I94S probably damaging Het
Olfr414 T A 1: 174,430,563 I45N possibly damaging Het
Olfr632 T C 7: 103,937,764 I128T probably benign Het
Olfr695 A T 7: 106,873,877 Y123N probably damaging Het
Osmr A C 15: 6,824,518 W570G probably damaging Het
Otol1 A T 3: 70,027,784 I370F probably damaging Het
Pank2 A G 2: 131,280,260 Y235C probably damaging Het
Pias2 T C 18: 77,105,885 S187P probably damaging Het
Pkhd1l1 A G 15: 44,519,690 N1115S probably benign Het
Pld1 G T 3: 28,109,817 A800S probably damaging Het
Prex2 T C 1: 11,186,633 probably benign Het
Ptpn3 T C 4: 57,194,304 Q908R probably benign Het
Rab3gap2 T A 1: 185,252,392 probably benign Het
Rbm24 A T 13: 46,420,350 N82Y probably damaging Het
Rpl27 T C 11: 101,445,255 V47A possibly damaging Het
Serpina1f A G 12: 103,693,567 V152A possibly damaging Het
Serpina5 A G 12: 104,102,133 Y151C probably damaging Het
Serpinb7 A G 1: 107,452,007 *381W probably null Het
Sh2b2 A G 5: 136,232,263 F33S probably damaging Het
Slc22a2 A C 17: 12,615,272 I476L probably benign Het
Slc6a12 A T 6: 121,355,372 I222F probably benign Het
Smim26 G A 2: 144,595,113 D61N probably damaging Het
Soat1 A T 1: 156,441,354 Y209N probably benign Het
Sptlc2 A T 12: 87,346,806 probably null Het
Strn3 G A 12: 51,610,404 T642I probably damaging Het
Syce1l T A 8: 113,654,068 D137E possibly damaging Het
Syne2 T C 12: 75,982,063 probably null Het
Tcf25 C A 8: 123,381,464 P86Q probably benign Het
Tmem19 A T 10: 115,361,810 Y43* probably null Het
Tmem30b T C 12: 73,546,168 N58D probably benign Het
Tnn A C 1: 160,120,757 I795M probably damaging Het
Tnpo1 A G 13: 98,855,446 Y641H probably damaging Het
Tra2a A T 6: 49,250,955 probably benign Het
Trappc8 A T 18: 20,866,186 F295I probably benign Het
Vmn2r101 T A 17: 19,588,983 W125R probably damaging Het
Vps8 C A 16: 21,442,357 F82L probably damaging Het
Ythdf2 A T 4: 132,204,468 S460R probably damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7267:Sorl1 UTSW 9 42124079 missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
R7272:Sorl1 UTSW 9 42063710 splice site probably null
R7537:Sorl1 UTSW 9 41980688 missense probably benign 0.01
R7615:Sorl1 UTSW 9 41977582 missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42092334 missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41984526 missense probably damaging 1.00
R7763:Sorl1 UTSW 9 42043909 missense probably damaging 1.00
R7831:Sorl1 UTSW 9 42089961 missense probably benign 0.17
R7956:Sorl1 UTSW 9 41989359 missense probably damaging 1.00
R7964:Sorl1 UTSW 9 41991401 missense probably damaging 1.00
R7977:Sorl1 UTSW 9 41977561 missense probably damaging 1.00
R7987:Sorl1 UTSW 9 41977561 missense probably damaging 1.00
R8151:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R8261:Sorl1 UTSW 9 42014481 missense probably damaging 1.00
R8283:Sorl1 UTSW 9 42030998 missense probably damaging 1.00
R8308:Sorl1 UTSW 9 42018160 missense probably damaging 1.00
R8348:Sorl1 UTSW 9 41991745 missense probably benign 0.35
R8448:Sorl1 UTSW 9 41991745 missense probably benign 0.35
Z1176:Sorl1 UTSW 9 42099203 missense possibly damaging 0.64
Z1176:Sorl1 UTSW 9 42123948 missense probably benign 0.03
Z1177:Sorl1 UTSW 9 41991638 missense possibly damaging 0.92
Z1177:Sorl1 UTSW 9 42106541 missense probably benign 0.00
Z1177:Sorl1 UTSW 9 42123912 missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGAAAAGGGCTGCTACATGCTCTAATG -3'
(R):5'- ATGGCCCCTCTGTGACAGCGTC -3'

Sequencing Primer
(F):5'- gggatggaaagacaggaagag -3'
(R):5'- TGTGACAGCGTCCTACTTG -3'
Posted On2013-05-23