Mutagenetix > Incidental Mutations

Incidental Mutation 'R5377:Exd2'

425636

Institutional Source

Beutler Lab

Gene Symbol

Exd2

Ensembl Gene

ENSMUSG00000032705

Gene Name

exonuclease 3'-5' domain containing 2

Synonyms

4930539P14Rik, Exdl2

MMRRC Submission

042845-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R5377 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80463095-80500227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80489448 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 284 (L284P)

Ref Sequence

ENSEMBL: ENSMUSP00000043049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038185] [ENSMUST00000219039]

Predicted Effect

probably damaging
Transcript: ENSMUST00000038185
AA Change: L284P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000043049
Gene: ENSMUSG00000032705
AA Change: L284P

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	40	72	N/A	INTRINSIC
35EXOc	105	291	3.8e-10	SMART
Blast:HNHc	438	492	1e-6	BLAST
low complexity region	517	532	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218565

Predicted Effect

probably benign
Transcript: ENSMUST00000219039

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219757

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220239

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,645,253	V372F	probably benign	Het
Adcy10	G	A	1: 165,519,895	C393Y	probably damaging	Het
Adgrg7	A	C	16: 56,730,306	I681S	possibly damaging	Het
Akap8l	T	C	17: 32,321,511		probably benign	Het
Akr1a1	A	T	4: 116,639,895	V156E	probably damaging	Het
Alk	T	G	17: 71,895,739	D1167A	probably damaging	Het
Ankrd11	T	C	8: 122,893,714		probably null	Het
Aspm	T	A	1: 139,457,483	N288K	probably damaging	Het
Aspm	A	G	1: 139,470,395		probably null	Het
Asxl2	G	A	12: 3,474,618		probably null	Het
Atp6v0a1	A	G	11: 101,055,587	H802R	probably damaging	Het
B4galnt1	A	G	10: 127,171,822	T531A	possibly damaging	Het
Ccdc114	C	T	7: 45,942,082	R257*	probably null	Het
Cecr2	A	G	6: 120,756,569	N506D	possibly damaging	Het
Crebrf	T	C	17: 26,759,865	V509A	probably damaging	Het
Cyp4f40	A	T	17: 32,675,616	I413F	probably null	Het
Defb12	C	A	8: 19,114,326		probably null	Het
Dnah2	T	C	11: 69,421,848	E4297G	probably damaging	Het
Dpysl5	A	T	5: 30,791,513	N371Y	probably damaging	Het
Eef1d	G	T	15: 75,903,189	T207N	probably benign	Het
Esrrb	C	T	12: 86,519,009	Q416*	probably null	Het
Fat3	T	A	9: 16,376,443	I595F	probably benign	Het
Gm9920	A	G	15: 55,108,975		probably benign	Het
Hephl1	T	C	9: 15,069,788	K783E	probably damaging	Het
Irs2	A	G	8: 11,005,277	S1052P	probably benign	Het
Kctd18	T	C	1: 57,963,093	I192V	probably benign	Het
Lama3	A	G	18: 12,453,746	D722G	probably damaging	Het
Lepr	T	C	4: 101,815,019	V1080A	possibly damaging	Het
Lpin1	C	T	12: 16,563,655	G504S	probably damaging	Het
Lrit2	A	C	14: 37,069,183	Q273P	possibly damaging	Het
Mgea5	A	T	19: 45,758,022	Y779*	probably null	Het
Mlkl	T	A	8: 111,327,937	E189D	probably benign	Het
Mttp	C	T	3: 138,105,029	R608H	probably benign	Het
Nav2	T	C	7: 49,589,160	V2011A	probably benign	Het
Nos2	A	T	11: 78,957,491	I1075F	probably benign	Het
Npat	A	G	9: 53,550,036		probably null	Het
Nucks1	T	C	1: 131,919,033	F16L	probably damaging	Het
Nus1	T	C	10: 52,429,213	S150P	possibly damaging	Het
Olfr1230	G	T	2: 89,297,162	T36K	probably damaging	Het
Olfr881	A	T	9: 37,992,612	Y40F	probably benign	Het
Pclo	A	G	5: 14,681,353	T3290A	unknown	Het
Pign	A	T	1: 105,657,812	F4Y	probably benign	Het
Rfx4	A	G	10: 84,860,542	N233D	possibly damaging	Het
Rpgrip1	A	T	14: 52,160,195	M1325L	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Scaf11	T	A	15: 96,417,120	H1227L	possibly damaging	Het
Sec31b	G	T	19: 44,518,637	P840T	probably damaging	Het
Slc16a9	T	A	10: 70,283,128	L426I	probably damaging	Het
Slc17a2	T	C	13: 23,812,592	S27P	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Tacc1	A	G	8: 25,182,283	S310P	possibly damaging	Het
Tmem245	G	A	4: 56,947,084	R110C	probably damaging	Het
Trip12	T	C	1: 84,757,431	Y953C	probably damaging	Het
Trpm7	C	A	2: 126,842,855		probably null	Het
Ush2a	G	A	1: 188,912,123	V4561I	probably benign	Het
Vmn1r192	C	T	13: 22,187,631	V140I	probably benign	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	T	C	17: 19,379,269	V405A	probably damaging	Het
Wdhd1	A	C	14: 47,272,221	V172G	probably benign	Het
Zfhx3	C	T	8: 108,951,185	R2956C	possibly damaging	Het
Zfp446	T	C	7: 12,982,251	L283P	possibly damaging	Het
Zfp82	T	C	7: 30,057,166	K164E	probably damaging	Het

Other mutations in Exd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Exd2	APN	12	80476166	missense	probably damaging	1.00
IGL00546:Exd2	APN	12	80480547	missense	probably benign	0.05
IGL02964:Exd2	APN	12	80480528	missense	probably damaging	0.99
IGL03036:Exd2	APN	12	80489411	missense	probably damaging	1.00
R0304:Exd2	UTSW	12	80491240	unclassified	probably benign
R0436:Exd2	UTSW	12	80490770	splice site	probably benign
R1290:Exd2	UTSW	12	80484326	missense	probably benign	0.00
R1772:Exd2	UTSW	12	80489479	missense	probably benign	0.00
R2102:Exd2	UTSW	12	80480603	missense	possibly damaging	0.78
R2104:Exd2	UTSW	12	80496801	missense	probably benign	0.01
R2408:Exd2	UTSW	12	80484241	splice site	probably benign
R3693:Exd2	UTSW	12	80480693	missense	probably damaging	1.00
R4748:Exd2	UTSW	12	80480576	missense	probably damaging	1.00
R4773:Exd2	UTSW	12	80475818	missense	possibly damaging	0.46
R5022:Exd2	UTSW	12	80496790	missense	probably damaging	1.00
R5057:Exd2	UTSW	12	80496790	missense	probably damaging	1.00
R5179:Exd2	UTSW	12	80484344	missense	probably damaging	1.00
R7246:Exd2	UTSW	12	80480535	missense	probably damaging	1.00
R7761:Exd2	UTSW	12	80475772	missense	probably damaging	0.98
R7776:Exd2	UTSW	12	80492560	missense	probably damaging	1.00
R8032:Exd2	UTSW	12	80489653	missense	probably benign	0.00
R8420:Exd2	UTSW	12	80475997	missense	probably benign
RF013:Exd2	UTSW	12	80475932	frame shift	probably null
RF015:Exd2	UTSW	12	80475917	intron	probably benign
RF022:Exd2	UTSW	12	80475917	intron	probably benign
RF023:Exd2	UTSW	12	80475915	intron	probably benign
RF025:Exd2	UTSW	12	80475955	intron	probably benign
RF029:Exd2	UTSW	12	80475946	frame shift	probably null
RF035:Exd2	UTSW	12	80475900	intron	probably benign
RF035:Exd2	UTSW	12	80475955	intron	probably benign
RF039:Exd2	UTSW	12	80475941	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CGAGTGCTGGGATTAAAGGC -3'
(R):5'- TGGCACCATTCTATCAGTCTTAGC -3'

Sequencing Primer
(F):5'- CTGGGATTAAAGGCGTGCGC -3'
(R):5'- TCTCGGCTTCAGCTGCGAC -3'

Posted On

2016-08-04