Incidental Mutation 'R0492:Impg1'
ID 42564
Institutional Source Beutler Lab
Gene Symbol Impg1
Ensembl Gene ENSMUSG00000032343
Gene Name interphotoreceptor matrix proteoglycan 1
Synonyms SPACR, A930015H12Rik, IMP150
MMRRC Submission 038690-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R0492 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 80220612-80347534 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80252590 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 453 (D453G)
Ref Sequence ENSEMBL: ENSMUSP00000082395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085289] [ENSMUST00000113250]
AlphaFold Q8R1W8
Predicted Effect possibly damaging
Transcript: ENSMUST00000085289
AA Change: D453G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000082395
Gene: ENSMUSG00000032343
AA Change: D453G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SEA 158 273 8.68e-1 SMART
low complexity region 353 374 N/A INTRINSIC
SEA 494 616 1.37e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113250
AA Change: D530G

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108876
Gene: ENSMUSG00000032343
AA Change: D530G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SEA 235 350 8.68e-1 SMART
low complexity region 430 451 N/A INTRINSIC
SEA 571 693 1.37e-11 SMART
Meta Mutation Damage Score 0.1010 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a major component of the retinal interphotoreceptor matrix. The encoded protein is a proteoglycan that is thought to play a role in maintaining viability of photoreceptor cells and in adhesion of the neural retina to the retinal pigment epithelium. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 C G 4: 129,901,624 (GRCm39) P416R probably damaging Het
Adgre1 A G 17: 57,709,742 (GRCm39) D133G unknown Het
Alpl A C 4: 137,476,887 (GRCm39) probably null Het
Ankrd65 T C 4: 155,875,133 (GRCm39) probably benign Het
Baalc A T 15: 38,797,480 (GRCm39) probably benign Het
Bpifb5 A G 2: 154,070,820 (GRCm39) T204A probably benign Het
Bud31 A G 5: 145,083,265 (GRCm39) Y77C probably damaging Het
Calhm6 G A 10: 34,003,647 (GRCm39) R87* probably null Het
Capsl A G 15: 9,461,930 (GRCm39) probably benign Het
Ccna1 A G 3: 54,956,004 (GRCm39) V116A probably damaging Het
Cdc42bpa C A 1: 179,928,755 (GRCm39) H723N probably benign Het
Cfap161 T C 7: 83,443,245 (GRCm39) I40V possibly damaging Het
CK137956 C T 4: 127,845,093 (GRCm39) V217I probably benign Het
Cog5 A G 12: 31,919,460 (GRCm39) T540A probably damaging Het
Cps1 T C 1: 67,196,995 (GRCm39) W349R probably damaging Het
Crispld2 G T 8: 120,752,806 (GRCm39) V285L probably benign Het
Crtc2 T A 3: 90,170,804 (GRCm39) F626I probably damaging Het
Daam1 G A 12: 71,991,154 (GRCm39) R256H unknown Het
Dhx38 G T 8: 110,288,576 (GRCm39) probably benign Het
Dok4 G A 8: 95,591,764 (GRCm39) A324V probably benign Het
Dscam T C 16: 96,626,982 (GRCm39) probably null Het
Dusp16 A T 6: 134,695,365 (GRCm39) S489T probably benign Het
Ecpas A G 4: 58,864,418 (GRCm39) W288R probably damaging Het
Erbin A T 13: 103,970,866 (GRCm39) Y917N probably damaging Het
F13b A T 1: 139,450,297 (GRCm39) probably null Het
Fdx1 C A 9: 51,874,725 (GRCm39) A15S probably benign Het
Ffar4 A T 19: 38,085,630 (GRCm39) Q19L probably benign Het
Folh1 A C 7: 86,395,400 (GRCm39) V344G probably damaging Het
Fscb T A 12: 64,520,292 (GRCm39) E391D possibly damaging Het
Gigyf2 G A 1: 87,368,568 (GRCm39) G1083R probably damaging Het
Gm14403 C A 2: 177,200,359 (GRCm39) H102N probably benign Het
Gm4847 A G 1: 166,457,961 (GRCm39) F464S probably damaging Het
Gpam A T 19: 55,084,611 (GRCm39) M56K possibly damaging Het
Gpr165 T A X: 95,760,778 (GRCm39) F352I probably damaging Het
Grik2 T G 10: 48,977,260 (GRCm39) I891L probably damaging Het
Gsr T C 8: 34,171,603 (GRCm39) probably benign Het
Hhla1 A G 15: 65,808,140 (GRCm39) F302L probably benign Het
Inpp5d T A 1: 87,625,872 (GRCm39) V495E possibly damaging Het
Iqca1l A T 5: 24,759,626 (GRCm39) L48Q probably damaging Het
Iqce A T 5: 140,660,990 (GRCm39) L450H probably damaging Het
Itfg2 A G 6: 128,390,486 (GRCm39) probably null Het
Kif13a A G 13: 46,966,218 (GRCm39) V400A possibly damaging Het
Kif7 T C 7: 79,363,629 (GRCm39) Y93C probably damaging Het
Krt33a A G 11: 99,906,909 (GRCm39) V22A probably benign Het
Lct T C 1: 128,228,319 (GRCm39) D1058G probably damaging Het
Lrp6 G T 6: 134,457,481 (GRCm39) D774E possibly damaging Het
Lrrc9 T A 12: 72,525,537 (GRCm39) S828R possibly damaging Het
Ly75 A G 2: 60,138,620 (GRCm39) W1416R probably damaging Het
Mdh2 T C 5: 135,819,004 (GRCm39) I320T possibly damaging Het
Med13l T A 5: 118,876,560 (GRCm39) V912E probably damaging Het
Mgarp T C 3: 51,296,456 (GRCm39) D182G possibly damaging Het
Mllt10 T C 2: 18,151,698 (GRCm39) probably benign Het
Mmp28 G A 11: 83,334,629 (GRCm39) A375V probably damaging Het
Mrps23 T A 11: 88,101,511 (GRCm39) H133Q probably benign Het
Msh6 T C 17: 88,282,679 (GRCm39) S35P probably benign Het
Myo3a A G 2: 22,328,447 (GRCm39) D347G possibly damaging Het
Npc1l1 T C 11: 6,173,040 (GRCm39) K800E possibly damaging Het
Or2ag13 A T 7: 106,473,084 (GRCm39) Y123N probably damaging Het
Or51ai2 T C 7: 103,586,971 (GRCm39) I128T probably benign Het
Or5i1 T G 2: 87,613,166 (GRCm39) I94S probably damaging Het
Or5m9 T C 2: 85,876,931 (GRCm39) V35A probably benign Het
Or5m9 T C 2: 85,877,278 (GRCm39) F151L possibly damaging Het
Or5t7 G A 2: 86,506,834 (GRCm39) P281L probably damaging Het
Or6p1 T A 1: 174,258,129 (GRCm39) I45N possibly damaging Het
Osmr A C 15: 6,853,999 (GRCm39) W570G probably damaging Het
Otol1 A T 3: 69,935,117 (GRCm39) I370F probably damaging Het
Pank2 A G 2: 131,122,180 (GRCm39) Y235C probably damaging Het
Pias2 T C 18: 77,193,581 (GRCm39) S187P probably damaging Het
Pkhd1l1 A G 15: 44,383,086 (GRCm39) N1115S probably benign Het
Pld1 G T 3: 28,163,966 (GRCm39) A800S probably damaging Het
Prex2 T C 1: 11,256,857 (GRCm39) probably benign Het
Ptpn3 T C 4: 57,194,304 (GRCm39) Q908R probably benign Het
Rab3gap2 T A 1: 184,984,589 (GRCm39) probably benign Het
Rbm24 A T 13: 46,573,826 (GRCm39) N82Y probably damaging Het
Rpl27 T C 11: 101,336,081 (GRCm39) V47A possibly damaging Het
Serpina1f A G 12: 103,659,826 (GRCm39) V152A possibly damaging Het
Serpina5 A G 12: 104,068,392 (GRCm39) Y151C probably damaging Het
Serpinb7 A G 1: 107,379,737 (GRCm39) *381W probably null Het
Sh2b2 A G 5: 136,261,117 (GRCm39) F33S probably damaging Het
Slc22a2 A C 17: 12,834,159 (GRCm39) I476L probably benign Het
Slc6a12 A T 6: 121,332,331 (GRCm39) I222F probably benign Het
Smim26 G A 2: 144,437,033 (GRCm39) D61N probably damaging Het
Soat1 A T 1: 156,268,924 (GRCm39) Y209N probably benign Het
Sorl1 T C 9: 41,902,667 (GRCm39) H1630R probably null Het
Sptlc2 A T 12: 87,393,580 (GRCm39) probably null Het
Strn3 G A 12: 51,657,187 (GRCm39) T642I probably damaging Het
Syce1l T A 8: 114,380,700 (GRCm39) D137E possibly damaging Het
Syne2 T C 12: 76,028,837 (GRCm39) probably null Het
Tcf25 C A 8: 124,108,203 (GRCm39) P86Q probably benign Het
Tmem19 A T 10: 115,197,715 (GRCm39) Y43* probably null Het
Tmem30b T C 12: 73,592,942 (GRCm39) N58D probably benign Het
Tnn A C 1: 159,948,327 (GRCm39) I795M probably damaging Het
Tnpo1 A G 13: 98,991,954 (GRCm39) Y641H probably damaging Het
Tra2a A T 6: 49,227,889 (GRCm39) probably benign Het
Trappc8 A T 18: 20,999,243 (GRCm39) F295I probably benign Het
Vmn2r101 T A 17: 19,809,245 (GRCm39) W125R probably damaging Het
Vps8 C A 16: 21,261,107 (GRCm39) F82L probably damaging Het
Ythdf2 A T 4: 131,931,779 (GRCm39) S460R probably damaging Het
Other mutations in Impg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Impg1 APN 9 80,230,111 (GRCm39) missense probably benign 0.02
IGL01733:Impg1 APN 9 80,249,206 (GRCm39) missense probably damaging 0.99
IGL02333:Impg1 APN 9 80,322,808 (GRCm39) missense possibly damaging 0.74
IGL03097:Impg1 UTSW 9 80,287,234 (GRCm39) missense possibly damaging 0.48
R0021:Impg1 UTSW 9 80,317,479 (GRCm39) missense probably damaging 1.00
R0029:Impg1 UTSW 9 80,305,653 (GRCm39) missense probably damaging 1.00
R0029:Impg1 UTSW 9 80,305,653 (GRCm39) missense probably damaging 1.00
R0108:Impg1 UTSW 9 80,230,130 (GRCm39) missense possibly damaging 0.63
R0201:Impg1 UTSW 9 80,252,843 (GRCm39) missense probably damaging 1.00
R0271:Impg1 UTSW 9 80,294,161 (GRCm39) splice site probably benign
R0316:Impg1 UTSW 9 80,249,347 (GRCm39) missense probably damaging 1.00
R0633:Impg1 UTSW 9 80,301,437 (GRCm39) missense possibly damaging 0.72
R0705:Impg1 UTSW 9 80,287,261 (GRCm39) missense probably damaging 1.00
R0962:Impg1 UTSW 9 80,289,023 (GRCm39) missense probably benign 0.23
R1264:Impg1 UTSW 9 80,221,675 (GRCm39) missense probably benign 0.31
R1707:Impg1 UTSW 9 80,285,799 (GRCm39) splice site probably null
R2017:Impg1 UTSW 9 80,322,720 (GRCm39) missense probably damaging 1.00
R3904:Impg1 UTSW 9 80,252,867 (GRCm39) missense possibly damaging 0.76
R3960:Impg1 UTSW 9 80,322,917 (GRCm39) missense probably benign 0.00
R4231:Impg1 UTSW 9 80,252,611 (GRCm39) missense probably damaging 1.00
R4233:Impg1 UTSW 9 80,252,611 (GRCm39) missense probably damaging 1.00
R4235:Impg1 UTSW 9 80,252,611 (GRCm39) missense probably damaging 1.00
R4236:Impg1 UTSW 9 80,252,611 (GRCm39) missense probably damaging 1.00
R4490:Impg1 UTSW 9 80,301,341 (GRCm39) missense probably damaging 1.00
R4592:Impg1 UTSW 9 80,322,907 (GRCm39) missense probably benign 0.05
R4701:Impg1 UTSW 9 80,221,682 (GRCm39) missense probably benign 0.07
R4785:Impg1 UTSW 9 80,305,732 (GRCm39) missense probably benign 0.01
R4796:Impg1 UTSW 9 80,301,377 (GRCm39) missense probably damaging 0.99
R4923:Impg1 UTSW 9 80,252,827 (GRCm39) missense probably damaging 0.98
R4923:Impg1 UTSW 9 80,252,360 (GRCm39) nonsense probably null
R5468:Impg1 UTSW 9 80,347,318 (GRCm39) missense probably benign 0.05
R5596:Impg1 UTSW 9 80,252,500 (GRCm39) missense probably benign 0.24
R6001:Impg1 UTSW 9 80,223,454 (GRCm39) missense probably benign 0.12
R6156:Impg1 UTSW 9 80,230,106 (GRCm39) missense probably damaging 1.00
R6315:Impg1 UTSW 9 80,301,356 (GRCm39) missense probably benign 0.21
R6419:Impg1 UTSW 9 80,287,300 (GRCm39) missense probably benign 0.38
R6880:Impg1 UTSW 9 80,312,082 (GRCm39) missense probably damaging 1.00
R7013:Impg1 UTSW 9 80,285,776 (GRCm39) missense probably damaging 1.00
R8542:Impg1 UTSW 9 80,312,080 (GRCm39) missense probably damaging 1.00
R9018:Impg1 UTSW 9 80,301,474 (GRCm39) missense probably benign 0.19
R9034:Impg1 UTSW 9 80,347,351 (GRCm39) start gained probably benign
R9174:Impg1 UTSW 9 80,252,750 (GRCm39) missense probably damaging 0.99
R9242:Impg1 UTSW 9 80,289,064 (GRCm39) missense probably damaging 1.00
R9344:Impg1 UTSW 9 80,312,040 (GRCm39) missense probably benign 0.39
R9380:Impg1 UTSW 9 80,289,077 (GRCm39) missense probably benign 0.34
R9584:Impg1 UTSW 9 80,322,849 (GRCm39) missense probably benign 0.14
R9594:Impg1 UTSW 9 80,288,923 (GRCm39) missense probably damaging 1.00
R9632:Impg1 UTSW 9 80,287,276 (GRCm39) missense probably benign 0.24
R9710:Impg1 UTSW 9 80,287,276 (GRCm39) missense probably benign 0.24
Z1176:Impg1 UTSW 9 80,285,749 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCAGGCTGAAGAATACCACTAGCTC -3'
(R):5'- ATGGCATCAGGAATGTCCTCCAAAG -3'

Sequencing Primer
(F):5'- GAATACCACTAGCTCCTGGC -3'
(R):5'- AAAGACAGTTCTTGGTCTCCAC -3'
Posted On 2013-05-23