Mutagenetix > Incidental Mutations

Incidental Mutation 'R5377:Wdhd1'

425642

Institutional Source

Beutler Lab

Gene Symbol

Wdhd1

Ensembl Gene

ENSMUSG00000037572

Gene Name

WD repeat and HMG-box DNA binding protein 1

Synonyms

AND-1, D630024B06Rik

MMRRC Submission

042845-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5377 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47240944-47276857 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 47272221 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 172 (V172G)

Ref Sequence

ENSEMBL: ENSMUSP00000141182 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065562] [ENSMUST00000111790] [ENSMUST00000111791] [ENSMUST00000111792] [ENSMUST00000187531] [ENSMUST00000227413]

Predicted Effect

probably benign
Transcript: ENSMUST00000065562

SMART Domains

Protein: ENSMUSP00000066031
Gene: ENSMUSG00000048379

Domain	Start	End	E-Value	Type
low complexity region	30	47	N/A	INTRINSIC
Pfam:SOCS	55	108	6.8e-23	PFAM
low complexity region	219	232	N/A	INTRINSIC
SH2	281	367	1.11e-16	SMART
SOCS	377	420	1.69e-16	SMART
SOCS_box	383	419	1.13e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111790
AA Change: V172G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000107420
Gene: ENSMUSG00000037572
AA Change: V172G

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	353	363	N/A	INTRINSIC
Pfam:DUF3639	525	551	2.4e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111791
AA Change: V172G

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000107421
Gene: ENSMUSG00000037572
AA Change: V172G

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	353	363	N/A	INTRINSIC
Pfam:Mcl1_mid	424	708	1.6e-103	PFAM
coiled coil region	802	834	N/A	INTRINSIC
HMG	1003	1073	2.64e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111792
AA Change: V172G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000107422
Gene: ENSMUSG00000037572
AA Change: V172G

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	316	326	N/A	INTRINSIC
Pfam:DUF3639	488	514	7.1e-13	PFAM
coiled coil region	765	797	N/A	INTRINSIC
HMG	966	1036	2.64e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122699

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139124

Predicted Effect

probably benign
Transcript: ENSMUST00000187531
AA Change: V172G

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000141182
Gene: ENSMUSG00000037572
AA Change: V172G

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	353	363	N/A	INTRINSIC
Pfam:DUF3639	525	551	3e-13	PFAM
coiled coil region	802	834	N/A	INTRINSIC
HMG	1003	1073	2.64e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227413

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228623

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains multiple N-terminal WD40 domains and a C-terminal high mobility group (HMG) box. WD40 domains are found in a variety of eukaryotic proteins and may function as adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,645,253	V372F	probably benign	Het
Adcy10	G	A	1: 165,519,895	C393Y	probably damaging	Het
Adgrg7	A	C	16: 56,730,306	I681S	possibly damaging	Het
Akap8l	T	C	17: 32,321,511		probably benign	Het
Akr1a1	A	T	4: 116,639,895	V156E	probably damaging	Het
Alk	T	G	17: 71,895,739	D1167A	probably damaging	Het
Ankrd11	T	C	8: 122,893,714		probably null	Het
Aspm	T	A	1: 139,457,483	N288K	probably damaging	Het
Aspm	A	G	1: 139,470,395		probably null	Het
Asxl2	G	A	12: 3,474,618		probably null	Het
Atp6v0a1	A	G	11: 101,055,587	H802R	probably damaging	Het
B4galnt1	A	G	10: 127,171,822	T531A	possibly damaging	Het
Ccdc114	C	T	7: 45,942,082	R257*	probably null	Het
Cecr2	A	G	6: 120,756,569	N506D	possibly damaging	Het
Crebrf	T	C	17: 26,759,865	V509A	probably damaging	Het
Cyp4f40	A	T	17: 32,675,616	I413F	probably null	Het
Defb12	C	A	8: 19,114,326		probably null	Het
Dnah2	T	C	11: 69,421,848	E4297G	probably damaging	Het
Dpysl5	A	T	5: 30,791,513	N371Y	probably damaging	Het
Eef1d	G	T	15: 75,903,189	T207N	probably benign	Het
Esrrb	C	T	12: 86,519,009	Q416*	probably null	Het
Exd2	T	C	12: 80,489,448	L284P	probably damaging	Het
Fat3	T	A	9: 16,376,443	I595F	probably benign	Het
Gm9920	A	G	15: 55,108,975		probably benign	Het
Hephl1	T	C	9: 15,069,788	K783E	probably damaging	Het
Irs2	A	G	8: 11,005,277	S1052P	probably benign	Het
Kctd18	T	C	1: 57,963,093	I192V	probably benign	Het
Lama3	A	G	18: 12,453,746	D722G	probably damaging	Het
Lepr	T	C	4: 101,815,019	V1080A	possibly damaging	Het
Lpin1	C	T	12: 16,563,655	G504S	probably damaging	Het
Lrit2	A	C	14: 37,069,183	Q273P	possibly damaging	Het
Mgea5	A	T	19: 45,758,022	Y779*	probably null	Het
Mlkl	T	A	8: 111,327,937	E189D	probably benign	Het
Mttp	C	T	3: 138,105,029	R608H	probably benign	Het
Nav2	T	C	7: 49,589,160	V2011A	probably benign	Het
Nos2	A	T	11: 78,957,491	I1075F	probably benign	Het
Npat	A	G	9: 53,550,036		probably null	Het
Nucks1	T	C	1: 131,919,033	F16L	probably damaging	Het
Nus1	T	C	10: 52,429,213	S150P	possibly damaging	Het
Olfr1230	G	T	2: 89,297,162	T36K	probably damaging	Het
Olfr881	A	T	9: 37,992,612	Y40F	probably benign	Het
Pclo	A	G	5: 14,681,353	T3290A	unknown	Het
Pign	A	T	1: 105,657,812	F4Y	probably benign	Het
Rfx4	A	G	10: 84,860,542	N233D	possibly damaging	Het
Rpgrip1	A	T	14: 52,160,195	M1325L	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Scaf11	T	A	15: 96,417,120	H1227L	possibly damaging	Het
Sec31b	G	T	19: 44,518,637	P840T	probably damaging	Het
Slc16a9	T	A	10: 70,283,128	L426I	probably damaging	Het
Slc17a2	T	C	13: 23,812,592	S27P	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Tacc1	A	G	8: 25,182,283	S310P	possibly damaging	Het
Tmem245	G	A	4: 56,947,084	R110C	probably damaging	Het
Trip12	T	C	1: 84,757,431	Y953C	probably damaging	Het
Trpm7	C	A	2: 126,842,855		probably null	Het
Ush2a	G	A	1: 188,912,123	V4561I	probably benign	Het
Vmn1r192	C	T	13: 22,187,631	V140I	probably benign	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	T	C	17: 19,379,269	V405A	probably damaging	Het
Zfhx3	C	T	8: 108,951,185	R2956C	possibly damaging	Het
Zfp446	T	C	7: 12,982,251	L283P	possibly damaging	Het
Zfp82	T	C	7: 30,057,166	K164E	probably damaging	Het

Other mutations in Wdhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01335:Wdhd1	APN	14	47250782	missense	possibly damaging	0.87
IGL01789:Wdhd1	APN	14	47274817	missense	probably benign	0.10
IGL01981:Wdhd1	APN	14	47261450	missense	probably damaging	1.00
IGL02034:Wdhd1	APN	14	47261351	missense	probably benign	0.02
IGL02932:Wdhd1	APN	14	47272134	critical splice donor site	probably null
IGL02966:Wdhd1	APN	14	47241644	missense	possibly damaging	0.93
IGL03355:Wdhd1	APN	14	47243889	missense	possibly damaging	0.78
R0165:Wdhd1	UTSW	14	47267068	missense	probably benign	0.00
R0414:Wdhd1	UTSW	14	47276588	missense	probably benign
R0603:Wdhd1	UTSW	14	47263586	missense	probably damaging	1.00
R1503:Wdhd1	UTSW	14	47247400	missense	probably benign	0.00
R1539:Wdhd1	UTSW	14	47245050	missense	possibly damaging	0.63
R1541:Wdhd1	UTSW	14	47268192	nonsense	probably null
R1588:Wdhd1	UTSW	14	47256236	missense	probably damaging	1.00
R1686:Wdhd1	UTSW	14	47256215	missense	probably damaging	1.00
R1916:Wdhd1	UTSW	14	47258577	missense	possibly damaging	0.89
R1952:Wdhd1	UTSW	14	47270190	missense	probably damaging	1.00
R2320:Wdhd1	UTSW	14	47274028	missense	probably benign	0.06
R2421:Wdhd1	UTSW	14	47258584	missense	probably benign	0.00
R3731:Wdhd1	UTSW	14	47247892	missense	possibly damaging	0.89
R3818:Wdhd1	UTSW	14	47243801	critical splice donor site	probably null
R3836:Wdhd1	UTSW	14	47245054	missense	probably benign	0.01
R4789:Wdhd1	UTSW	14	47268692	missense	probably benign	0.01
R4963:Wdhd1	UTSW	14	47268689	missense	possibly damaging	0.66
R4994:Wdhd1	UTSW	14	47268654	critical splice donor site	probably null
R5225:Wdhd1	UTSW	14	47250816	missense	probably benign	0.01
R5347:Wdhd1	UTSW	14	47268724	nonsense	probably null
R6038:Wdhd1	UTSW	14	47263580	missense	possibly damaging	0.89
R6038:Wdhd1	UTSW	14	47263580	missense	possibly damaging	0.89
R6046:Wdhd1	UTSW	14	47273210	nonsense	probably null
R6156:Wdhd1	UTSW	14	47268196	missense	probably damaging	0.99
R6289:Wdhd1	UTSW	14	47258496	missense	possibly damaging	0.95
R6298:Wdhd1	UTSW	14	47273122	missense	possibly damaging	0.67
R6345:Wdhd1	UTSW	14	47251922	missense	probably damaging	0.99
R6405:Wdhd1	UTSW	14	47243867	missense	possibly damaging	0.91
R6500:Wdhd1	UTSW	14	47250760	splice site	probably null
R6564:Wdhd1	UTSW	14	47248042	missense	probably benign
R6897:Wdhd1	UTSW	14	47248130	missense	probably damaging	1.00
R7262:Wdhd1	UTSW	14	47251973	missense	probably benign	0.08
R7444:Wdhd1	UTSW	14	47251948	nonsense	probably null
R7496:Wdhd1	UTSW	14	47274024	missense	probably benign	0.39
R7503:Wdhd1	UTSW	14	47250791	missense	probably benign	0.25
R8317:Wdhd1	UTSW	14	47263537	missense	probably damaging	1.00
R8323:Wdhd1	UTSW	14	47274795	missense	possibly damaging	0.85
R8331:Wdhd1	UTSW	14	47272245	splice site	probably null
R8338:Wdhd1	UTSW	14	47268663	missense	probably benign
R8363:Wdhd1	UTSW	14	47276532	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGTTCCATTAGGCATTCATGG -3'
(R):5'- GTCATTCATGGAGATCGCCTC -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCAGGAGG -3'
(R):5'- CCCGTTAAACCTCAGCTT -3'

Posted On

2016-08-04