Mutagenetix > Incidental Mutations

Incidental Mutation 'R5377:Scaf11'

425645

Institutional Source

Beutler Lab

Gene Symbol

Scaf11

Ensembl Gene

ENSMUSG00000033228

Gene Name

SR-related CTD-associated factor 11

Synonyms

Srsf2ip, Sfrs2ip, SIP1, CASP11, 1110061H03Rik, SRRP129, 2610510E10Rik

MMRRC Submission

042845-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5377 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96411699-96460843 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 96417120 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1227 (H1227L)

Ref Sequence

ENSEMBL: ENSMUSP00000044898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047835] [ENSMUST00000227069] [ENSMUST00000228535]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047835
AA Change: H1227L

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000044898
Gene: ENSMUSG00000033228
AA Change: H1227L

Domain	Start	End	E-Value	Type
RING	41	81	1.57e-2	SMART
low complexity region	308	327	N/A	INTRINSIC
low complexity region	376	394	N/A	INTRINSIC
low complexity region	398	412	N/A	INTRINSIC
low complexity region	852	860	N/A	INTRINSIC
low complexity region	919	978	N/A	INTRINSIC
low complexity region	1089	1108	N/A	INTRINSIC
low complexity region	1177	1188	N/A	INTRINSIC
low complexity region	1283	1311	N/A	INTRINSIC
low complexity region	1346	1359	N/A	INTRINSIC
Blast:IG_like	1374	1415	5e-9	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000227069
AA Change: H1227L

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

unknown
Transcript: ENSMUST00000228072
AA Change: H230L

Predicted Effect

probably benign
Transcript: ENSMUST00000228535

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,645,253	V372F	probably benign	Het
Adcy10	G	A	1: 165,519,895	C393Y	probably damaging	Het
Adgrg7	A	C	16: 56,730,306	I681S	possibly damaging	Het
Akap8l	T	C	17: 32,321,511		probably benign	Het
Akr1a1	A	T	4: 116,639,895	V156E	probably damaging	Het
Alk	T	G	17: 71,895,739	D1167A	probably damaging	Het
Ankrd11	T	C	8: 122,893,714		probably null	Het
Aspm	T	A	1: 139,457,483	N288K	probably damaging	Het
Aspm	A	G	1: 139,470,395		probably null	Het
Asxl2	G	A	12: 3,474,618		probably null	Het
Atp6v0a1	A	G	11: 101,055,587	H802R	probably damaging	Het
B4galnt1	A	G	10: 127,171,822	T531A	possibly damaging	Het
Ccdc114	C	T	7: 45,942,082	R257*	probably null	Het
Cecr2	A	G	6: 120,756,569	N506D	possibly damaging	Het
Crebrf	T	C	17: 26,759,865	V509A	probably damaging	Het
Cyp4f40	A	T	17: 32,675,616	I413F	probably null	Het
Defb12	C	A	8: 19,114,326		probably null	Het
Dnah2	T	C	11: 69,421,848	E4297G	probably damaging	Het
Dpysl5	A	T	5: 30,791,513	N371Y	probably damaging	Het
Eef1d	G	T	15: 75,903,189	T207N	probably benign	Het
Esrrb	C	T	12: 86,519,009	Q416*	probably null	Het
Exd2	T	C	12: 80,489,448	L284P	probably damaging	Het
Fat3	T	A	9: 16,376,443	I595F	probably benign	Het
Gm9920	A	G	15: 55,108,975		probably benign	Het
Hephl1	T	C	9: 15,069,788	K783E	probably damaging	Het
Irs2	A	G	8: 11,005,277	S1052P	probably benign	Het
Kctd18	T	C	1: 57,963,093	I192V	probably benign	Het
Lama3	A	G	18: 12,453,746	D722G	probably damaging	Het
Lepr	T	C	4: 101,815,019	V1080A	possibly damaging	Het
Lpin1	C	T	12: 16,563,655	G504S	probably damaging	Het
Lrit2	A	C	14: 37,069,183	Q273P	possibly damaging	Het
Mgea5	A	T	19: 45,758,022	Y779*	probably null	Het
Mlkl	T	A	8: 111,327,937	E189D	probably benign	Het
Mttp	C	T	3: 138,105,029	R608H	probably benign	Het
Nav2	T	C	7: 49,589,160	V2011A	probably benign	Het
Nos2	A	T	11: 78,957,491	I1075F	probably benign	Het
Npat	A	G	9: 53,550,036		probably null	Het
Nucks1	T	C	1: 131,919,033	F16L	probably damaging	Het
Nus1	T	C	10: 52,429,213	S150P	possibly damaging	Het
Olfr1230	G	T	2: 89,297,162	T36K	probably damaging	Het
Olfr881	A	T	9: 37,992,612	Y40F	probably benign	Het
Pclo	A	G	5: 14,681,353	T3290A	unknown	Het
Pign	A	T	1: 105,657,812	F4Y	probably benign	Het
Rfx4	A	G	10: 84,860,542	N233D	possibly damaging	Het
Rpgrip1	A	T	14: 52,160,195	M1325L	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sec31b	G	T	19: 44,518,637	P840T	probably damaging	Het
Slc16a9	T	A	10: 70,283,128	L426I	probably damaging	Het
Slc17a2	T	C	13: 23,812,592	S27P	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Tacc1	A	G	8: 25,182,283	S310P	possibly damaging	Het
Tmem245	G	A	4: 56,947,084	R110C	probably damaging	Het
Trip12	T	C	1: 84,757,431	Y953C	probably damaging	Het
Trpm7	C	A	2: 126,842,855		probably null	Het
Ush2a	G	A	1: 188,912,123	V4561I	probably benign	Het
Vmn1r192	C	T	13: 22,187,631	V140I	probably benign	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	T	C	17: 19,379,269	V405A	probably damaging	Het
Wdhd1	A	C	14: 47,272,221	V172G	probably benign	Het
Zfhx3	C	T	8: 108,951,185	R2956C	possibly damaging	Het
Zfp446	T	C	7: 12,982,251	L283P	possibly damaging	Het
Zfp82	T	C	7: 30,057,166	K164E	probably damaging	Het

Other mutations in Scaf11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Scaf11	APN	15	96418580	missense	possibly damaging	0.94
IGL01386:Scaf11	APN	15	96420480	missense	probably damaging	1.00
IGL01449:Scaf11	APN	15	96419126	missense	probably benign	0.04
IGL01547:Scaf11	APN	15	96418429	missense	probably benign	0.14
IGL01697:Scaf11	APN	15	96423623	splice site	probably benign
IGL01780:Scaf11	APN	15	96420844	missense	possibly damaging	0.94
IGL02311:Scaf11	APN	15	96418756	missense	probably benign	0.01
IGL02740:Scaf11	APN	15	96419002	missense	probably benign	0.01
IGL02805:Scaf11	APN	15	96420182	missense	possibly damaging	0.69
IGL03383:Scaf11	APN	15	96420183	unclassified	probably null
R0173:Scaf11	UTSW	15	96420194	missense	probably benign	0.00
R0379:Scaf11	UTSW	15	96431816	missense	probably damaging	1.00
R0508:Scaf11	UTSW	15	96420487	missense	probably damaging	1.00
R0648:Scaf11	UTSW	15	96418458	missense	possibly damaging	0.72
R0653:Scaf11	UTSW	15	96418641	nonsense	probably null
R0727:Scaf11	UTSW	15	96419443	missense	probably damaging	1.00
R0829:Scaf11	UTSW	15	96418689	missense	probably damaging	1.00
R0839:Scaf11	UTSW	15	96423553	missense	probably damaging	1.00
R0843:Scaf11	UTSW	15	96431825	missense	probably damaging	1.00
R0882:Scaf11	UTSW	15	96418295	missense	possibly damaging	0.75
R1994:Scaf11	UTSW	15	96418840	nonsense	probably null
R2092:Scaf11	UTSW	15	96415827	missense	probably damaging	0.98
R2125:Scaf11	UTSW	15	96419315	missense	possibly damaging	0.69
R2200:Scaf11	UTSW	15	96420523	missense	probably damaging	1.00
R3409:Scaf11	UTSW	15	96414864	missense	probably damaging	1.00
R3751:Scaf11	UTSW	15	96418536	missense	probably damaging	0.99
R4308:Scaf11	UTSW	15	96446515	missense	probably benign	0.00
R4424:Scaf11	UTSW	15	96418428	missense	possibly damaging	0.78
R4519:Scaf11	UTSW	15	96424838	missense	probably damaging	1.00
R4646:Scaf11	UTSW	15	96420100	unclassified	probably null
R4647:Scaf11	UTSW	15	96420100	unclassified	probably null
R4724:Scaf11	UTSW	15	96414848	missense	probably benign	0.40
R4748:Scaf11	UTSW	15	96420421	nonsense	probably null
R4926:Scaf11	UTSW	15	96418242	missense	possibly damaging	0.87
R4978:Scaf11	UTSW	15	96415917	missense	probably damaging	1.00
R5105:Scaf11	UTSW	15	96420432	missense	probably damaging	1.00
R5120:Scaf11	UTSW	15	96419542	missense	probably benign	0.26
R5277:Scaf11	UTSW	15	96419226	missense	probably damaging	1.00
R5394:Scaf11	UTSW	15	96419458	missense	probably benign	0.28
R5481:Scaf11	UTSW	15	96420617	missense	probably damaging	1.00
R5831:Scaf11	UTSW	15	96417081	missense	probably benign	0.14
R5941:Scaf11	UTSW	15	96420308	missense	probably damaging	0.99
R6123:Scaf11	UTSW	15	96420454	missense	probably benign	0.29
R6166:Scaf11	UTSW	15	96424662	missense	probably damaging	1.00
R6504:Scaf11	UTSW	15	96419460	unclassified	probably null
R6863:Scaf11	UTSW	15	96419419	missense	probably damaging	1.00
R7135:Scaf11	UTSW	15	96420328	missense	possibly damaging	0.82
R7193:Scaf11	UTSW	15	96419161	missense	probably damaging	1.00
R7384:Scaf11	UTSW	15	96420387	missense	possibly damaging	0.92
R7790:Scaf11	UTSW	15	96419061	missense	possibly damaging	0.60
R8056:Scaf11	UTSW	15	96414817	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTACCTGCATGAGAGGAAC -3'
(R):5'- TGCTATGTAACCTGGCATTAGTAAC -3'

Sequencing Primer
(F):5'- AAGGGTTCCGCTGCATAT -3'
(R):5'- CCTGGCATTAGTAACTTAGAGAATG -3'

Posted On

2016-08-04