Mutagenetix > Incidental Mutations

Incidental Mutation 'R5377:Alk'

425652

Institutional Source

Beutler Lab

Gene Symbol

Alk

Ensembl Gene

ENSMUSG00000055471

Gene Name

anaplastic lymphoma kinase

Synonyms

CD246, Tcrz

MMRRC Submission

042845-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.225) question?

Stock #

R5377 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71869442-72603709 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 71895739 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 1167 (D1167A)

Ref Sequence

ENSEMBL: ENSMUSP00000083840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086639]

Predicted Effect

probably damaging
Transcript: ENSMUST00000086639
AA Change: D1167A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000083840
Gene: ENSMUSG00000055471
AA Change: D1167A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	99	109	N/A	INTRINSIC
low complexity region	230	242	N/A	INTRINSIC
Pfam:MAM	270	431	5.6e-10	PFAM
LDLa	441	477	5.59e-3	SMART
Pfam:MAM	484	640	5.6e-22	PFAM
Pfam:Gly_rich	730	996	8.6e-19	PFAM
low complexity region	1037	1057	N/A	INTRINSIC
TyrKc	1120	1387	2.76e-140	SMART
low complexity region	1440	1480	N/A	INTRINSIC
low complexity region	1551	1570	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele show increased ethanol consumption and increased sedation in response to ethanol. Male mice homozygous for a different null allele show delayed puberty, hypogonadotropic hypogonadism, reduced serum testosterone levels, and altered seminiferous tubule morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,645,253	V372F	probably benign	Het
Adcy10	G	A	1: 165,519,895	C393Y	probably damaging	Het
Adgrg7	A	C	16: 56,730,306	I681S	possibly damaging	Het
Akap8l	T	C	17: 32,321,511		probably benign	Het
Akr1a1	A	T	4: 116,639,895	V156E	probably damaging	Het
Ankrd11	T	C	8: 122,893,714		probably null	Het
Aspm	T	A	1: 139,457,483	N288K	probably damaging	Het
Aspm	A	G	1: 139,470,395		probably null	Het
Asxl2	G	A	12: 3,474,618		probably null	Het
Atp6v0a1	A	G	11: 101,055,587	H802R	probably damaging	Het
B4galnt1	A	G	10: 127,171,822	T531A	possibly damaging	Het
Ccdc114	C	T	7: 45,942,082	R257*	probably null	Het
Cecr2	A	G	6: 120,756,569	N506D	possibly damaging	Het
Crebrf	T	C	17: 26,759,865	V509A	probably damaging	Het
Cyp4f40	A	T	17: 32,675,616	I413F	probably null	Het
Defb12	C	A	8: 19,114,326		probably null	Het
Dnah2	T	C	11: 69,421,848	E4297G	probably damaging	Het
Dpysl5	A	T	5: 30,791,513	N371Y	probably damaging	Het
Eef1d	G	T	15: 75,903,189	T207N	probably benign	Het
Esrrb	C	T	12: 86,519,009	Q416*	probably null	Het
Exd2	T	C	12: 80,489,448	L284P	probably damaging	Het
Fat3	T	A	9: 16,376,443	I595F	probably benign	Het
Gm9920	A	G	15: 55,108,975		probably benign	Het
Hephl1	T	C	9: 15,069,788	K783E	probably damaging	Het
Irs2	A	G	8: 11,005,277	S1052P	probably benign	Het
Kctd18	T	C	1: 57,963,093	I192V	probably benign	Het
Lama3	A	G	18: 12,453,746	D722G	probably damaging	Het
Lepr	T	C	4: 101,815,019	V1080A	possibly damaging	Het
Lpin1	C	T	12: 16,563,655	G504S	probably damaging	Het
Lrit2	A	C	14: 37,069,183	Q273P	possibly damaging	Het
Mgea5	A	T	19: 45,758,022	Y779*	probably null	Het
Mlkl	T	A	8: 111,327,937	E189D	probably benign	Het
Mttp	C	T	3: 138,105,029	R608H	probably benign	Het
Nav2	T	C	7: 49,589,160	V2011A	probably benign	Het
Nos2	A	T	11: 78,957,491	I1075F	probably benign	Het
Npat	A	G	9: 53,550,036		probably null	Het
Nucks1	T	C	1: 131,919,033	F16L	probably damaging	Het
Nus1	T	C	10: 52,429,213	S150P	possibly damaging	Het
Olfr1230	G	T	2: 89,297,162	T36K	probably damaging	Het
Olfr881	A	T	9: 37,992,612	Y40F	probably benign	Het
Pclo	A	G	5: 14,681,353	T3290A	unknown	Het
Pign	A	T	1: 105,657,812	F4Y	probably benign	Het
Rfx4	A	G	10: 84,860,542	N233D	possibly damaging	Het
Rpgrip1	A	T	14: 52,160,195	M1325L	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Scaf11	T	A	15: 96,417,120	H1227L	possibly damaging	Het
Sec31b	G	T	19: 44,518,637	P840T	probably damaging	Het
Slc16a9	T	A	10: 70,283,128	L426I	probably damaging	Het
Slc17a2	T	C	13: 23,812,592	S27P	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Tacc1	A	G	8: 25,182,283	S310P	possibly damaging	Het
Tmem245	G	A	4: 56,947,084	R110C	probably damaging	Het
Trip12	T	C	1: 84,757,431	Y953C	probably damaging	Het
Trpm7	C	A	2: 126,842,855		probably null	Het
Ush2a	G	A	1: 188,912,123	V4561I	probably benign	Het
Vmn1r192	C	T	13: 22,187,631	V140I	probably benign	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	T	C	17: 19,379,269	V405A	probably damaging	Het
Wdhd1	A	C	14: 47,272,221	V172G	probably benign	Het
Zfhx3	C	T	8: 108,951,185	R2956C	possibly damaging	Het
Zfp446	T	C	7: 12,982,251	L283P	possibly damaging	Het
Zfp82	T	C	7: 30,057,166	K164E	probably damaging	Het

Other mutations in Alk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Alk	APN	17	71895748	missense	probably damaging	1.00
IGL00796:Alk	APN	17	71905142	missense	possibly damaging	0.88
IGL01096:Alk	APN	17	71921896	missense	possibly damaging	0.87
IGL01367:Alk	APN	17	71900786	missense	probably damaging	1.00
IGL01402:Alk	APN	17	71874178	missense	probably damaging	1.00
IGL01652:Alk	APN	17	72603531	missense	probably damaging	1.00
IGL01717:Alk	APN	17	72603382	missense	probably benign
IGL02301:Alk	APN	17	71874176	missense	probably damaging	0.99
IGL02403:Alk	APN	17	71901393	missense	probably damaging	1.00
IGL02452:Alk	APN	17	71902625	nonsense	probably null
IGL02724:Alk	APN	17	71985460	missense	probably benign	0.00
IGL02826:Alk	APN	17	71869536	missense	probably damaging	1.00
IGL02863:Alk	APN	17	71897835	missense	probably damaging	1.00
IGL02994:Alk	APN	17	71949820	missense	probably benign	0.00
IGL03329:Alk	APN	17	71899164	splice site	probably benign
PIT4382001:Alk	UTSW	17	71949921	missense	probably benign
R0157:Alk	UTSW	17	71949845	missense	probably benign	0.00
R0211:Alk	UTSW	17	72603516	missense	probably damaging	1.00
R0257:Alk	UTSW	17	72603495	missense	probably damaging	1.00
R0269:Alk	UTSW	17	72603583	missense	probably damaging	1.00
R0395:Alk	UTSW	17	72603531	missense	probably damaging	0.99
R0414:Alk	UTSW	17	71899286	splice site	probably benign
R0466:Alk	UTSW	17	71905157	missense	possibly damaging	0.51
R0526:Alk	UTSW	17	71869753	missense	probably damaging	1.00
R0617:Alk	UTSW	17	72603583	missense	probably damaging	1.00
R0781:Alk	UTSW	17	71984745	splice site	probably benign
R0830:Alk	UTSW	17	72603200	missense	probably benign	0.01
R0835:Alk	UTSW	17	71869842	missense	probably damaging	0.97
R0894:Alk	UTSW	17	71895935	missense	probably damaging	1.00
R1110:Alk	UTSW	17	71984745	splice site	probably benign
R1170:Alk	UTSW	17	71900734	missense	probably damaging	1.00
R1573:Alk	UTSW	17	72603118	missense	possibly damaging	0.69
R1667:Alk	UTSW	17	71911567	missense	probably damaging	1.00
R1748:Alk	UTSW	17	72603421	missense	probably benign	0.19
R1767:Alk	UTSW	17	71900698	missense	possibly damaging	0.73
R1836:Alk	UTSW	17	71891037	missense	probably damaging	1.00
R1861:Alk	UTSW	17	71874938	splice site	probably benign
R2905:Alk	UTSW	17	71985494	missense	probably benign	0.40
R2925:Alk	UTSW	17	72603207	missense	probably benign
R3727:Alk	UTSW	17	71901400	splice site	probably benign
R3747:Alk	UTSW	17	71911565	missense	probably damaging	0.99
R3790:Alk	UTSW	17	72603432	missense	possibly damaging	0.95
R3909:Alk	UTSW	17	71897911	missense	probably benign	0.00
R3934:Alk	UTSW	17	72205954	missense	probably damaging	1.00
R3936:Alk	UTSW	17	72205954	missense	probably damaging	1.00
R3972:Alk	UTSW	17	71985447	missense	probably benign	0.16
R4433:Alk	UTSW	17	71899241	nonsense	probably null
R4716:Alk	UTSW	17	72205942	missense	probably damaging	1.00
R4903:Alk	UTSW	17	71869563	missense	probably damaging	1.00
R4921:Alk	UTSW	17	71904315	missense	probably benign	0.30
R4954:Alk	UTSW	17	71902692	nonsense	probably null
R5386:Alk	UTSW	17	71875012	missense	probably damaging	1.00
R5551:Alk	UTSW	17	71875033	missense	possibly damaging	0.53
R5704:Alk	UTSW	17	72603120	missense	probably damaging	1.00
R5877:Alk	UTSW	17	71967526	missense	probably damaging	1.00
R5888:Alk	UTSW	17	71874943	missense	probably damaging	1.00
R6013:Alk	UTSW	17	71900737	missense	probably benign	0.15
R6044:Alk	UTSW	17	71992100	missense	probably benign	0.00
R6058:Alk	UTSW	17	71869747	missense	probably benign	0.01
R6126:Alk	UTSW	17	71875042	missense	possibly damaging	0.82
R6286:Alk	UTSW	17	71880847	missense	probably damaging	0.98
R6744:Alk	UTSW	17	72603082	missense	probably benign	0.35
R6989:Alk	UTSW	17	71897952	missense	probably benign	0.00
R7487:Alk	UTSW	17	71949898	missense	probably benign
R7573:Alk	UTSW	17	71900792	missense	probably damaging	1.00
R7838:Alk	UTSW	17	71967554	missense	possibly damaging	0.53
R8055:Alk	UTSW	17	71899257	missense	probably benign	0.19
R8211:Alk	UTSW	17	71869707	missense	probably benign
R8555:Alk	UTSW	17	71921874	missense	probably damaging	1.00
RF013:Alk	UTSW	17	71895936	missense	probably damaging	1.00
RF018:Alk	UTSW	17	71949813	missense	probably benign	0.09
Z1088:Alk	UTSW	17	72205807	missense	probably damaging	0.96
Z1177:Alk	UTSW	17	72603063	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AGAAGGGAGTTTGCTTTCCTAAG -3'
(R):5'- GGAATGCCCAATGACCCAAG -3'

Sequencing Primer
(F):5'- CTCCCTAAGATAATCATTGTGGACTG -3'
(R):5'- GCCCTCTACAAGTGGCTGTAAAG -3'

Posted On

2016-08-04