Incidental Mutation 'R5377:Alk'
ID 425652
Institutional Source Beutler Lab
Gene Symbol Alk
Ensembl Gene ENSMUSG00000055471
Gene Name anaplastic lymphoma kinase
Synonyms CD246, Tcrz
MMRRC Submission 042845-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.162) question?
Stock # R5377 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 71869442-72603709 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 71895739 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 1167 (D1167A)
Ref Sequence ENSEMBL: ENSMUSP00000083840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086639]
AlphaFold P97793
Predicted Effect probably damaging
Transcript: ENSMUST00000086639
AA Change: D1167A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083840
Gene: ENSMUSG00000055471
AA Change: D1167A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
Pfam:MAM 270 431 5.6e-10 PFAM
LDLa 441 477 5.59e-3 SMART
Pfam:MAM 484 640 5.6e-22 PFAM
Pfam:Gly_rich 730 996 8.6e-19 PFAM
low complexity region 1037 1057 N/A INTRINSIC
TyrKc 1120 1387 2.76e-140 SMART
low complexity region 1440 1480 N/A INTRINSIC
low complexity region 1551 1570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele show increased ethanol consumption and increased sedation in response to ethanol. Male mice homozygous for a different null allele show delayed puberty, hypogonadotropic hypogonadism, reduced serum testosterone levels, and altered seminiferous tubule morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,645,253 V372F probably benign Het
Adcy10 G A 1: 165,519,895 C393Y probably damaging Het
Adgrg7 A C 16: 56,730,306 I681S possibly damaging Het
Akap8l T C 17: 32,321,511 probably benign Het
Akr1a1 A T 4: 116,639,895 V156E probably damaging Het
Ankrd11 T C 8: 122,893,714 probably null Het
Aspm T A 1: 139,457,483 N288K probably damaging Het
Aspm A G 1: 139,470,395 probably null Het
Asxl2 G A 12: 3,474,618 probably null Het
Atp6v0a1 A G 11: 101,055,587 H802R probably damaging Het
B4galnt1 A G 10: 127,171,822 T531A possibly damaging Het
Ccdc114 C T 7: 45,942,082 R257* probably null Het
Cecr2 A G 6: 120,756,569 N506D possibly damaging Het
Crebrf T C 17: 26,759,865 V509A probably damaging Het
Cyp4f40 A T 17: 32,675,616 I413F probably null Het
Defb12 C A 8: 19,114,326 probably null Het
Dnah2 T C 11: 69,421,848 E4297G probably damaging Het
Dpysl5 A T 5: 30,791,513 N371Y probably damaging Het
Eef1d G T 15: 75,903,189 T207N probably benign Het
Esrrb C T 12: 86,519,009 Q416* probably null Het
Exd2 T C 12: 80,489,448 L284P probably damaging Het
Fat3 T A 9: 16,376,443 I595F probably benign Het
Gm9920 A G 15: 55,108,975 probably benign Het
Hephl1 T C 9: 15,069,788 K783E probably damaging Het
Irs2 A G 8: 11,005,277 S1052P probably benign Het
Kctd18 T C 1: 57,963,093 I192V probably benign Het
Lama3 A G 18: 12,453,746 D722G probably damaging Het
Lepr T C 4: 101,815,019 V1080A possibly damaging Het
Lpin1 C T 12: 16,563,655 G504S probably damaging Het
Lrit2 A C 14: 37,069,183 Q273P possibly damaging Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Mlkl T A 8: 111,327,937 E189D probably benign Het
Mttp C T 3: 138,105,029 R608H probably benign Het
Nav2 T C 7: 49,589,160 V2011A probably benign Het
Nos2 A T 11: 78,957,491 I1075F probably benign Het
Npat A G 9: 53,550,036 probably null Het
Nucks1 T C 1: 131,919,033 F16L probably damaging Het
Nus1 T C 10: 52,429,213 S150P possibly damaging Het
Olfr1230 G T 2: 89,297,162 T36K probably damaging Het
Olfr881 A T 9: 37,992,612 Y40F probably benign Het
Pclo A G 5: 14,681,353 T3290A unknown Het
Pign A T 1: 105,657,812 F4Y probably benign Het
Rfx4 A G 10: 84,860,542 N233D possibly damaging Het
Rpgrip1 A T 14: 52,160,195 M1325L possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf11 T A 15: 96,417,120 H1227L possibly damaging Het
Sec31b G T 19: 44,518,637 P840T probably damaging Het
Slc16a9 T A 10: 70,283,128 L426I probably damaging Het
Slc17a2 T C 13: 23,812,592 S27P probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Tacc1 A G 8: 25,182,283 S310P possibly damaging Het
Tmem245 G A 4: 56,947,084 R110C probably damaging Het
Trip12 T C 1: 84,757,431 Y953C probably damaging Het
Trpm7 C A 2: 126,842,855 probably null Het
Ush2a G A 1: 188,912,123 V4561I probably benign Het
Vmn1r192 C T 13: 22,187,631 V140I probably benign Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 T C 17: 19,379,269 V405A probably damaging Het
Wdhd1 A C 14: 47,272,221 V172G probably benign Het
Zfhx3 C T 8: 108,951,185 R2956C possibly damaging Het
Zfp446 T C 7: 12,982,251 L283P possibly damaging Het
Zfp82 T C 7: 30,057,166 K164E probably damaging Het
Other mutations in Alk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Alk APN 17 71895748 missense probably damaging 1.00
IGL00796:Alk APN 17 71905142 missense possibly damaging 0.88
IGL01096:Alk APN 17 71921896 missense possibly damaging 0.87
IGL01367:Alk APN 17 71900786 missense probably damaging 1.00
IGL01402:Alk APN 17 71874178 missense probably damaging 1.00
IGL01652:Alk APN 17 72603531 missense probably damaging 1.00
IGL01717:Alk APN 17 72603382 missense probably benign
IGL02301:Alk APN 17 71874176 missense probably damaging 0.99
IGL02403:Alk APN 17 71901393 missense probably damaging 1.00
IGL02452:Alk APN 17 71902625 nonsense probably null
IGL02724:Alk APN 17 71985460 missense probably benign 0.00
IGL02826:Alk APN 17 71869536 missense probably damaging 1.00
IGL02863:Alk APN 17 71897835 missense probably damaging 1.00
IGL02994:Alk APN 17 71949820 missense probably benign 0.00
IGL03329:Alk APN 17 71899164 splice site probably benign
PIT4382001:Alk UTSW 17 71949921 missense probably benign
R0157:Alk UTSW 17 71949845 missense probably benign 0.00
R0211:Alk UTSW 17 72603516 missense probably damaging 1.00
R0257:Alk UTSW 17 72603495 missense probably damaging 1.00
R0269:Alk UTSW 17 72603583 missense probably damaging 1.00
R0395:Alk UTSW 17 72603531 missense probably damaging 0.99
R0414:Alk UTSW 17 71899286 splice site probably benign
R0466:Alk UTSW 17 71905157 missense possibly damaging 0.51
R0526:Alk UTSW 17 71869753 missense probably damaging 1.00
R0617:Alk UTSW 17 72603583 missense probably damaging 1.00
R0781:Alk UTSW 17 71984745 splice site probably benign
R0830:Alk UTSW 17 72603200 missense probably benign 0.01
R0835:Alk UTSW 17 71869842 missense probably damaging 0.97
R0894:Alk UTSW 17 71895935 missense probably damaging 1.00
R1110:Alk UTSW 17 71984745 splice site probably benign
R1170:Alk UTSW 17 71900734 missense probably damaging 1.00
R1573:Alk UTSW 17 72603118 missense possibly damaging 0.69
R1667:Alk UTSW 17 71911567 missense probably damaging 1.00
R1748:Alk UTSW 17 72603421 missense probably benign 0.19
R1767:Alk UTSW 17 71900698 missense possibly damaging 0.73
R1836:Alk UTSW 17 71891037 missense probably damaging 1.00
R1861:Alk UTSW 17 71874938 splice site probably benign
R2905:Alk UTSW 17 71985494 missense probably benign 0.40
R2925:Alk UTSW 17 72603207 missense probably benign
R3727:Alk UTSW 17 71901400 splice site probably benign
R3747:Alk UTSW 17 71911565 missense probably damaging 0.99
R3790:Alk UTSW 17 72603432 missense possibly damaging 0.95
R3909:Alk UTSW 17 71897911 missense probably benign 0.00
R3934:Alk UTSW 17 72205954 missense probably damaging 1.00
R3936:Alk UTSW 17 72205954 missense probably damaging 1.00
R3972:Alk UTSW 17 71985447 missense probably benign 0.16
R4433:Alk UTSW 17 71899241 nonsense probably null
R4716:Alk UTSW 17 72205942 missense probably damaging 1.00
R4903:Alk UTSW 17 71869563 missense probably damaging 1.00
R4921:Alk UTSW 17 71904315 missense probably benign 0.30
R4954:Alk UTSW 17 71902692 nonsense probably null
R5386:Alk UTSW 17 71875012 missense probably damaging 1.00
R5551:Alk UTSW 17 71875033 missense possibly damaging 0.53
R5704:Alk UTSW 17 72603120 missense probably damaging 1.00
R5877:Alk UTSW 17 71967526 missense probably damaging 1.00
R5888:Alk UTSW 17 71874943 missense probably damaging 1.00
R6013:Alk UTSW 17 71900737 missense probably benign 0.15
R6044:Alk UTSW 17 71992100 missense probably benign 0.00
R6058:Alk UTSW 17 71869747 missense probably benign 0.01
R6126:Alk UTSW 17 71875042 missense possibly damaging 0.82
R6286:Alk UTSW 17 71880847 missense probably damaging 0.98
R6744:Alk UTSW 17 72603082 missense probably benign 0.35
R6989:Alk UTSW 17 71897952 missense probably benign 0.00
R7487:Alk UTSW 17 71949898 missense probably benign
R7573:Alk UTSW 17 71900792 missense probably damaging 1.00
R7838:Alk UTSW 17 71967554 missense possibly damaging 0.53
R8055:Alk UTSW 17 71899257 missense probably benign 0.19
R8211:Alk UTSW 17 71869707 missense probably benign
R8555:Alk UTSW 17 71921874 missense probably damaging 1.00
R8676:Alk UTSW 17 71897941 missense probably damaging 0.98
R8847:Alk UTSW 17 71949825 missense probably benign 0.14
R8885:Alk UTSW 17 71895763 missense probably damaging 1.00
R9177:Alk UTSW 17 71874195 missense probably damaging 1.00
R9239:Alk UTSW 17 71949869 missense probably benign 0.04
R9268:Alk UTSW 17 71874195 missense probably damaging 1.00
R9682:Alk UTSW 17 71875063 missense possibly damaging 0.95
RF013:Alk UTSW 17 71895936 missense probably damaging 1.00
RF018:Alk UTSW 17 71949813 missense probably benign 0.09
Z1088:Alk UTSW 17 72205807 missense probably damaging 0.96
Z1177:Alk UTSW 17 72603063 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGAAGGGAGTTTGCTTTCCTAAG -3'
(R):5'- GGAATGCCCAATGACCCAAG -3'

Sequencing Primer
(F):5'- CTCCCTAAGATAATCATTGTGGACTG -3'
(R):5'- GCCCTCTACAAGTGGCTGTAAAG -3'
Posted On 2016-08-04